ID: 988744487

View in Genome Browser
Species Human (GRCh38)
Location 5:34120759-34120781
Sequence GACTCACGGTTCCACGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 21420
Summary {0: 11, 1: 635, 2: 4748, 3: 7908, 4: 8118}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988744487_988744492 16 Left 988744487 5:34120759-34120781 CCAGCCACGTGGAACCGTGAGTC 0: 11
1: 635
2: 4748
3: 7908
4: 8118
Right 988744492 5:34120798-34120820 TTTGTAAATTGCCCAGTTTCAGG 0: 72
1: 1383
2: 3255
3: 10785
4: 15479

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988744487 Original CRISPR GACTCACGGTTCCACGTGGC TGG (reversed) Intronic
Too many off-targets to display for this crispr