ID: 988744720

View in Genome Browser
Species Human (GRCh38)
Location 5:34123118-34123140
Sequence GGTCCAGGCAGAGAACCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 198}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988744717_988744720 -6 Left 988744717 5:34123101-34123123 CCCTGAGAGAGCTAGAAGGTCCA 0: 1
1: 0
2: 1
3: 4
4: 107
Right 988744720 5:34123118-34123140 GGTCCAGGCAGAGAACCCACAGG 0: 1
1: 0
2: 3
3: 26
4: 198
988744718_988744720 -7 Left 988744718 5:34123102-34123124 CCTGAGAGAGCTAGAAGGTCCAG 0: 1
1: 0
2: 0
3: 11
4: 146
Right 988744720 5:34123118-34123140 GGTCCAGGCAGAGAACCCACAGG 0: 1
1: 0
2: 3
3: 26
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988744720 Original CRISPR GGTCCAGGCAGAGAACCCAC AGG Intronic
900753792 1:4418941-4418963 TGTCCTGGTAGAGAACCCAAGGG - Intergenic
900766099 1:4506619-4506641 GCTCCTGGCAGTGGACCCACAGG + Intergenic
900978642 1:6033952-6033974 GGTCCAAGCAGGGAGCCCACAGG - Intronic
901082288 1:6590318-6590340 GGCCCGGGCAGAGGACCAACAGG + Intergenic
903808588 1:26022191-26022213 GGACCAGTCAGAGCTCCCACAGG - Exonic
904624750 1:31796163-31796185 GCTCCAGGCAGGGAACCACCCGG - Intronic
904772342 1:32887098-32887120 GGCCCAGGCTAAGGACCCACCGG - Intronic
905225050 1:36473480-36473502 GGTGCAGGCAGAGAATGCGCTGG - Exonic
905888955 1:41507962-41507984 GGCTCAGGCAGAGAAGCCACAGG - Exonic
907441989 1:54484654-54484676 TGTCCAGGCTGAGAAATCACGGG - Intergenic
908466837 1:64404493-64404515 GGCCAAGGCAAAGAACCCAATGG - Intergenic
909180652 1:72419775-72419797 CGTCCTGGCACAGAACCTACTGG - Intergenic
910867453 1:91801401-91801423 TGGCCAGGGAGAGAATCCACTGG + Intronic
912566852 1:110593459-110593481 GGTCCAGGCAGAGACCAGGCAGG - Intergenic
913344725 1:117796915-117796937 GGGCCAGGGAGATAACCCAAAGG - Intergenic
915973696 1:160371252-160371274 GGCACAGGCAGAGAGCCCACCGG + Exonic
919749254 1:201026315-201026337 AGTCCAGTCAGAGAACTCTCAGG - Intergenic
920440752 1:205979056-205979078 GGCCCAGACAGGGAAGCCACTGG + Intronic
922775430 1:228212332-228212354 GGTCCGCGCCGAGAACCCGCTGG + Exonic
1063208697 10:3858676-3858698 GGTCTAAGCAGAAAACTCACAGG + Intergenic
1064432412 10:15282658-15282680 GGTCCATGCTGAGAAGTCACTGG - Intronic
1065204068 10:23341752-23341774 GTTCCAGGCAGAGAGAACACTGG - Intronic
1070866786 10:79711895-79711917 GGACGAGGCAGAGCACACACTGG + Exonic
1070880575 10:79850016-79850038 GGACGAGGCAGAGCACACACTGG + Exonic
1071633697 10:87234118-87234140 GGACGAGGCAGAGCACACACTGG + Exonic
1071647145 10:87366334-87366356 GGACGAGGCAGAGCACACACTGG + Exonic
1073586127 10:104711844-104711866 CCTCCAGGCACAGAACTCACAGG - Intronic
1076510734 10:131012156-131012178 GGTCCACGCAGAGGCACCACAGG - Intergenic
1077008768 11:370856-370878 GGTACAGGAAGAGAACACAGGGG - Intronic
1078307359 11:10203351-10203373 GCATCAGGCAGAGAACCCAGAGG + Intronic
1083171194 11:60924813-60924835 GGTTCAGTCCGAGAACCCAAAGG - Intronic
1084275137 11:68047527-68047549 GGTCCTTGCGGAGAACCGACCGG + Exonic
1086735550 11:90301814-90301836 TGTCCACTCAGAGACCCCACTGG - Intergenic
1089687826 11:120168381-120168403 GGTCCAGGCAGGCACCCAACTGG + Intronic
1089729327 11:120510978-120511000 GGACCAGGCCAAGAACACACGGG - Intergenic
1092518686 12:9242761-9242783 GGTCCTGGAAGACAACACACAGG + Intergenic
1093416549 12:18927131-18927153 GGTGCAGGCAGAGAAGACTCTGG - Intergenic
1094631530 12:32180231-32180253 GGTCCAGGCAGGAAATCCTCTGG - Intronic
1096077415 12:48814346-48814368 GGTCCAGAGAGAGAGCCAACTGG + Intronic
1096389838 12:51219439-51219461 AGTCCAGGGAGAGAAACTACAGG - Intergenic
1101752723 12:107596237-107596259 GGGCCAGGCAGGAAACACACGGG + Intronic
1102510869 12:113414567-113414589 GGTCCAGGCACAGGACTCAGGGG - Intronic
1102590878 12:113955922-113955944 GTTTCAGGAAGAGAACCCTCTGG - Intronic
1103070939 12:117941272-117941294 GGGCCAGGCAGGAAACCCACAGG - Intronic
1105963812 13:25367320-25367342 AGTCCAGGCAGAAAGGCCACAGG + Intergenic
1106072217 13:26423867-26423889 GGCCCTGGCAGAGAACCGTCTGG - Intergenic
1106598632 13:31168779-31168801 GGCCCAGGCAGATAACCCGCCGG + Intergenic
1107164903 13:37272490-37272512 GAGCCAGGCAGACAACCCAGAGG - Intergenic
1107707695 13:43123439-43123461 TCCCCAGGCAGAGAGCCCACTGG + Intergenic
1108460560 13:50662984-50663006 GGGCCAGGCAGAGAAGCAAAAGG - Intronic
1113412738 13:110104820-110104842 GGCCCAGGCAGAGAAGCCTGAGG - Intergenic
1113521965 13:110947679-110947701 GGGCCAGGGACAGAAGCCACAGG + Intergenic
1113705926 13:112433017-112433039 GGGCCAGGGACAGAAGCCACAGG - Intronic
1113889181 13:113727009-113727031 GGACCAGGCAGAGAGGCCGCAGG - Intronic
1113968169 13:114166524-114166546 GGCCCTGGCGGAGAACCCATGGG - Intergenic
1114624474 14:24119843-24119865 TGTCCAGCCAGTGCACCCACAGG - Exonic
1117529524 14:56645804-56645826 GGCTCAGGAAGAGAAACCACTGG + Intronic
1118757507 14:68855598-68855620 GGTCCAAGCACAGAACCCGCTGG - Intergenic
1119608358 14:76040798-76040820 GCTCCAGGGAGAGAACTGACTGG - Intronic
1121627696 14:95398662-95398684 GGTCCAGGGAGAAAGCACACTGG - Intergenic
1122427288 14:101619495-101619517 GGTCCAGGCAGAAAACTCTGGGG + Intergenic
1122451092 14:101808181-101808203 CCTCCAGACAGACAACCCACAGG + Intronic
1122773202 14:104106255-104106277 GGTCCTGGCAGAGGCCCCACAGG - Intronic
1122773216 14:104106294-104106316 GGTCCTGGCAGAGGCCCCACAGG - Intronic
1128339453 15:66810244-66810266 GGGCCAGGCAGAGGACTCAGGGG + Intergenic
1131536887 15:93245146-93245168 GGCGCAAGAAGAGAACCCACAGG - Intergenic
1131546990 15:93323937-93323959 TGACCAAGCAGAGAACCCTCAGG - Intergenic
1132389439 15:101427717-101427739 GGCCCAGGCAGCTGACCCACAGG - Intronic
1132764691 16:1528222-1528244 GGGACAGGCAGAGGACGCACTGG + Intronic
1132804191 16:1768177-1768199 GCTGCAGGGAGAGAACCCAGAGG - Exonic
1132954660 16:2585326-2585348 GGTCCAGGCAGGGAGCTCCCAGG + Intronic
1133988135 16:10684057-10684079 GGTCCAGGCTTAGAACCTTCTGG - Intronic
1136450648 16:30352705-30352727 AGTCCAGGCAGGGAGGCCACAGG + Exonic
1137673077 16:50290794-50290816 TGTCAATGCAGAGAACTCACAGG - Intronic
1137673826 16:50294012-50294034 GCTGCAGGCAGAGGACCCAGGGG - Intronic
1138624305 16:58236982-58237004 TGTCCAGGCAGAGGAACTACCGG + Intronic
1142314486 16:89334969-89334991 GGTCCAGGAGGAGATCCCACAGG + Intronic
1143368314 17:6422682-6422704 TGTCCAGCCAGGGAGCCCACAGG + Intronic
1143775371 17:9195580-9195602 GGTGGATGCAGAGAACCCCCAGG + Intronic
1144444349 17:15313373-15313395 GGGCCTGGCAAAGAAACCACTGG + Intronic
1144944256 17:18961729-18961751 GGTCCATCCAGAGCCCCCACGGG + Intronic
1144968691 17:19093738-19093760 GGCCCAGGCAGGGACCCCTCTGG + Exonic
1144979223 17:19158328-19158350 GGCCCAGGCAGGGACCCCTCTGG - Exonic
1144988999 17:19219904-19219926 GGCCCAGGCAGGGACCCCTCTGG + Exonic
1145999512 17:29122832-29122854 GGTCCGGGTAGAGCACCCTCTGG - Intronic
1146828597 17:36047065-36047087 GGACCTGTCAGAGAACCCATGGG + Intergenic
1147382963 17:40066288-40066310 GCACTTGGCAGAGAACCCACAGG + Intronic
1148324803 17:46776989-46777011 GGTCCAGCAGCAGAACCCACAGG + Intronic
1148465993 17:47865637-47865659 TGGCCTGGAAGAGAACCCACTGG - Intergenic
1150602727 17:66664449-66664471 GGCCCAGTCAGAGAACCCAAAGG + Intronic
1151574899 17:74948072-74948094 GGTCCAGGCAGAGAATAAATTGG + Intronic
1151766690 17:76136723-76136745 GGGCCAGGCAAAGACCCCAGAGG + Exonic
1151852887 17:76701440-76701462 GGTGCACGTAGACAACCCACAGG + Intronic
1152018523 17:77768066-77768088 GGTCCAAGAACAGAACCCAGAGG - Intergenic
1156453339 18:37279065-37279087 GGTACAGGCAGAGAAGGCCCTGG + Intronic
1157251222 18:46098030-46098052 TGTCCAGCCGGAGAAGCCACGGG + Intronic
1159143076 18:64420491-64420513 TGTCCAAACAGAGGACCCACTGG - Intergenic
1160446128 18:78928115-78928137 AGTCCAGGCACTGAATCCACTGG + Intergenic
1162067216 19:8133129-8133151 GGTCCAGGCAGGGACCACACTGG + Intronic
1162834413 19:13306899-13306921 GGACCAAGCAGAGAAGCAACAGG - Intronic
1163179875 19:15591885-15591907 GGTCCTGGCAGGGAACCCACAGG + Intergenic
1164845008 19:31424574-31424596 CTGCCAGGCAGAGAAACCACCGG + Intergenic
1165682944 19:37792993-37793015 GGAGCAGGCAGAGAGCCCAGAGG - Intronic
1165718073 19:38059715-38059737 GGTCCAGAAAGAGAACCTGCTGG + Intronic
1166182567 19:41119217-41119239 GGTCCAGGAAGAGAAGAGACGGG + Intronic
1168213607 19:54909399-54909421 GGTCCAGGCGGAGTTCCCCCTGG + Exonic
1168367918 19:55805339-55805361 AATCCAGGCATAGAACACACGGG + Intronic
928088725 2:28361245-28361267 GGACAAGCCAGAGATCCCACTGG + Intergenic
930107262 2:47650150-47650172 GCTCCAGGCTGGGAGCCCACAGG + Intergenic
932426252 2:71637329-71637351 GGTGCAAGCCGAGCACCCACAGG + Intronic
935663030 2:105486215-105486237 GCTGCAGGCAGAGATCCCTCTGG + Intergenic
936099949 2:109568253-109568275 GGGCCAGGCTGAGAATACACTGG - Intronic
936527201 2:113249334-113249356 GGTCCAGGCACTGAACACAAGGG + Intronic
936976923 2:118229840-118229862 AGTCCAGGCAGAGAAGCCACTGG - Intergenic
938114728 2:128595375-128595397 GCTCCAGGCAGAGACCCCATGGG + Intergenic
938376207 2:130808346-130808368 GGAACAGGCAGAGAACACCCTGG - Intergenic
944508486 2:200440436-200440458 GGCCCAGTCAGAGACCCCACTGG + Intronic
945835124 2:214830529-214830551 GGTTCAGACATGGAACCCACAGG - Intergenic
946255416 2:218438355-218438377 GGGCCAGGGCAAGAACCCACAGG - Intronic
948484317 2:238270877-238270899 GGTCAAGGCAAAGAACCCTCAGG + Intronic
948686336 2:239672119-239672141 GGTCCAGGAAGCGAAGGCACGGG - Intergenic
948783335 2:240338336-240338358 GGTCCAGGCAGAGGTGCCATGGG + Intergenic
1169019903 20:2321976-2321998 GCTCCTGGCAGAGCACCCAAGGG - Intronic
1170119356 20:12894974-12894996 GGTCCACCCAGATAACCCAGAGG - Intergenic
1170990800 20:21300509-21300531 TATACAGGCAGAGAACCCAGAGG - Intergenic
1171173790 20:23036449-23036471 AGCGCAGGCAGAGAACCCGCTGG - Exonic
1171227778 20:23455816-23455838 GCGACAGGAAGAGAACCCACGGG - Intergenic
1172623010 20:36331906-36331928 GTTCCAGGCAGGGAACAAACTGG + Intronic
1174402763 20:50284805-50284827 TGGCCAGGCAGAGAAAGCACGGG - Intergenic
1174622661 20:51888095-51888117 GGTCCAGCCACAGAAGCCACAGG + Intergenic
1178022187 21:28421784-28421806 GGAACAGGCAGATAACTCACCGG - Intergenic
1179071921 21:38079507-38079529 GGACCAGGCAGATACCCCATCGG + Intronic
1180832057 22:18911451-18911473 GTGCCAGGCAGTGAGCCCACGGG - Intronic
1180999468 22:19981376-19981398 GGCCCAGGCTCAGGACCCACCGG + Exonic
1181023869 22:20116910-20116932 GGTCTAGGCGGAGAACCGCCTGG - Exonic
1181067786 22:20314891-20314913 GTGCCAGGCAGTGAGCCCACGGG + Intronic
1181734654 22:24872252-24872274 GGGGCAGGCAAAGAACCCAGCGG - Intronic
1181871058 22:25899689-25899711 GGTTCAGCCAGAGCACCCACAGG - Intronic
1183684591 22:39354420-39354442 TATCCAGGCAGAGAACCCACAGG - Intronic
1183994075 22:41620410-41620432 GAGCGAGGCAGAGAACCCGCCGG + Intronic
1184381164 22:44145616-44145638 GGACCAGGCACAGGACCCAAGGG - Intronic
1185172466 22:49301891-49301913 GTTGCAGACAGAGACCCCACTGG + Intergenic
1185296238 22:50056696-50056718 GGTCCAGGCGGAGGACCCCAGGG - Intronic
1203282143 22_KI270734v1_random:136756-136778 GTGCCAGGCAGTGAGCCCACGGG - Intergenic
949681546 3:6519984-6520006 GGCCCAGGCAGAGTTGCCACAGG - Intergenic
950223206 3:11212479-11212501 AATCCAGGTAGAGGACCCACTGG + Intronic
952254768 3:31685598-31685620 GGGCCACGCAGGGAACACACCGG + Intronic
955755861 3:62224357-62224379 GTTCCAGAAAGAGAAACCACTGG - Intronic
957772048 3:84707251-84707273 GGACCTGTCAGAGAGCCCACAGG + Intergenic
958737496 3:98026212-98026234 GGTGCAGGCTGAGAGCGCACCGG + Intronic
959063338 3:101634984-101635006 GCTATAGGCGGAGAACCCACAGG - Intergenic
961649171 3:128408880-128408902 GGTCCAGGGAAGGTACCCACAGG + Intergenic
962506359 3:136050406-136050428 GCTCCAGGCTGAGAAACCTCAGG - Intronic
962926628 3:139999534-139999556 TGACCAAGCAGATAACCCACAGG - Intronic
962957450 3:140279250-140279272 GCTGCAGGCAGAGCTCCCACTGG + Intronic
965133073 3:164726214-164726236 GGTCCAGGTAGAGAGGCCACTGG - Intergenic
966847630 3:184142915-184142937 GATCCAGGCAGAGAATAAACTGG - Intronic
968961932 4:3750062-3750084 GGACCAGGCAGAGGACCCAGAGG + Intergenic
968962027 4:3750527-3750549 GGGCCAGGCACAGGACACACAGG + Intergenic
969345782 4:6569041-6569063 GGAGCAGGCAGAAAACCCACTGG + Intergenic
969392896 4:6902542-6902564 GGTTCCCGCAGAGGACCCACGGG + Intergenic
971520781 4:27547580-27547602 TCACCAGGCACAGAACCCACTGG - Intergenic
973538515 4:51909636-51909658 GGGACAGGCAGAGAACCCTGTGG + Intronic
976822414 4:89221339-89221361 GGCCAAGGCAGAAAAGCCACTGG - Intergenic
979224269 4:118265976-118265998 GGTCCAGGTACAGGATCCACTGG + Intergenic
986017532 5:3770828-3770850 GGTGCAGGCAAAGCACCCTCCGG - Intergenic
986179007 5:5376180-5376202 GGTGCAGGCAGAGAGCCCCTGGG + Intergenic
986272918 5:6249762-6249784 GGTGTTGGCAGAGCACCCACAGG - Intergenic
988744720 5:34123118-34123140 GGTCCAGGCAGAGAACCCACAGG + Intronic
989555423 5:42789278-42789300 GGACCTGTCAGAGAGCCCACAGG - Intronic
990843696 5:60112788-60112810 GGTCCAAGTAGAGAACACAGAGG + Intronic
997698450 5:135879817-135879839 TGTGCAGGCAGAGACCACACAGG - Intronic
999487801 5:152016796-152016818 TCTCCAGTCAGGGAACCCACTGG + Intergenic
1000656530 5:163885957-163885979 AGTACAGGCAAAGTACCCACAGG - Intergenic
1001601383 5:172931116-172931138 CGACCAGGCTTAGAACCCACAGG + Intronic
1002189128 5:177469783-177469805 GGCCCAGGCTGAGGACCCTCTGG + Intronic
1002879367 6:1237956-1237978 TGTCCAGGCTGGGAACTCACAGG - Intergenic
1006792914 6:36715491-36715513 GCTCCAGCCAGAGCCCCCACAGG + Exonic
1006797102 6:36738787-36738809 GCTTCAGGAAGAGAAGCCACAGG - Intergenic
1013354129 6:109332425-109332447 GGTGCAGGCAGAGTACCTGCAGG - Intergenic
1018073841 6:160191696-160191718 TCCCCAGGCAGAGAACCCCCAGG + Intronic
1019274387 7:168221-168243 GGCCCAGCCAGAGAAGCCACGGG - Intergenic
1019664728 7:2246125-2246147 GGGCTGGGCAGAGAACCCCCGGG - Intronic
1019907394 7:4075095-4075117 GGCCCAGGCAGAGACCCCAAAGG + Intronic
1019951867 7:4379676-4379698 GGTCCAACCAGAGTACCCATTGG + Intergenic
1023470342 7:40510946-40510968 GCTCCAGGAAGAGAAAACACAGG + Intronic
1023611150 7:41972336-41972358 CGTCAAGGCAGAGAAGCCAATGG - Exonic
1023911921 7:44562453-44562475 GATGCAGGCAGAGAATCCGCTGG + Intergenic
1024095252 7:45977619-45977641 AGAGCAGCCAGAGAACCCACTGG + Intergenic
1024542916 7:50493436-50493458 GGACCAGGCAGAGCATCCACAGG - Intronic
1026807224 7:73435980-73436002 GGACCAGGCTGAGTCCCCACAGG + Exonic
1029611461 7:101628737-101628759 GGTTCAGGCAGTGAGCCCACGGG + Intronic
1030956363 7:115857188-115857210 AGCCCAGGCATCGAACCCACCGG + Intergenic
1031947507 7:127857569-127857591 AGTCCAGGCAGGGAGGCCACGGG + Intronic
1032021258 7:128408236-128408258 GGTCCAGGCAGGGAACCCCGAGG + Intronic
1032447753 7:131999247-131999269 GGTCCAGGCGGAGAAGTCTCAGG + Intergenic
1032876637 7:136045353-136045375 ATTCCAGGCAGAGAACACAAGGG + Intergenic
1034093128 7:148382247-148382269 GGAACAGGGAGAGAAACCACGGG - Intronic
1034995909 7:155577289-155577311 GGTCCAGGCTGAAACACCACAGG + Intergenic
1035059017 7:156055448-156055470 GGTCCAAGCAGACCACTCACTGG - Intergenic
1035094794 7:156345573-156345595 GGCCCAGGCAGAGGCCCCAAGGG - Intergenic
1035238411 7:157515055-157515077 GAGCCAGGCAGAGGACCCTCAGG + Intergenic
1035775178 8:2182344-2182366 GGTGGAGGCAGAGAACCGGCAGG - Intergenic
1036943012 8:13069359-13069381 GGTCTAGGCAGAGAACAGAGAGG - Intergenic
1037960284 8:23092681-23092703 GGTGCAGCCAGAGAACCCCGGGG - Intronic
1037971788 8:23177038-23177060 GGTGCAGCCAGAGGACCCCCCGG + Intergenic
1038574984 8:28697447-28697469 GCTCCAGACAGAAGACCCACAGG + Intronic
1039793134 8:40891369-40891391 GGCCCATGGAGAGAACCCAAGGG - Intronic
1040609838 8:48973108-48973130 GGTGCAGGAAGAAAAACCACAGG - Intergenic
1042671335 8:71266743-71266765 GGACCAGGCAAGGAAACCACTGG - Intronic
1043139402 8:76569749-76569771 GGTCTATGCAGATATCCCACAGG - Intergenic
1045850056 8:106685392-106685414 GGAACAGGAAGAGACCCCACAGG - Intronic
1049398287 8:142412081-142412103 GTTGCAGGGAGAGAACTCACCGG + Intergenic
1049477275 8:142802580-142802602 GCTCCAGGCAGGGAAGCCAGAGG + Intergenic
1057310780 9:93941772-93941794 AGTCCAGTGAGAGAACACACAGG + Intergenic
1061193643 9:129095947-129095969 GCTGGAGGCAGAGAACCCACTGG - Intronic
1061400189 9:130364286-130364308 GGTCCAGGGGGAGAACTCATGGG - Intronic
1062207053 9:135343031-135343053 TCCCCAGGCAGAGACCCCACCGG - Intergenic
1062585111 9:137245669-137245691 GGTCTTGGCAGGGAACCCTCGGG + Exonic
1062722836 9:138053482-138053504 GGACCAGGCAGGGCACCTACGGG - Intronic
1188788407 X:34377741-34377763 GGGCCAAGCACAGAACCCAAGGG - Intergenic
1192445513 X:71208184-71208206 GGTCGAGCCATAGAACGCACTGG - Intergenic
1192962556 X:76145518-76145540 AGTTCGAGCAGAGAACCCACCGG - Intergenic
1192962977 X:76149569-76149591 AGTTCGAGCAGAGAACCCACCGG + Intergenic
1198007016 X:132505394-132505416 GGTCCAAGGACAGAACCCCCTGG + Intergenic
1198413390 X:136394395-136394417 GTTCCAGGCAGAGTTTCCACAGG - Intronic
1200062270 X:153488890-153488912 GGGCCAGGCAGGCCACCCACAGG + Intronic
1200214986 X:154364243-154364265 AGTCCAGGTAGAGCACCCACGGG - Exonic