ID: 988759591

View in Genome Browser
Species Human (GRCh38)
Location 5:34298827-34298849
Sequence CACCCGACACCCTCCCCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988759591_988759592 10 Left 988759591 5:34298827-34298849 CCTTGAGGGGAGGGTGTCGGGTG No data
Right 988759592 5:34298860-34298882 CTATTAGTTCCTATAAGAACTGG No data
988759591_988759594 28 Left 988759591 5:34298827-34298849 CCTTGAGGGGAGGGTGTCGGGTG No data
Right 988759594 5:34298878-34298900 ACTGGTTGTTAAAAATAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988759591 Original CRISPR CACCCGACACCCTCCCCTCA AGG (reversed) Intergenic
No off target data available for this crispr