ID: 988760671

View in Genome Browser
Species Human (GRCh38)
Location 5:34306906-34306928
Sequence TCTCAGATGGGGCAGCTGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6805
Summary {0: 20, 1: 340, 2: 723, 3: 1614, 4: 4108}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988760662_988760671 16 Left 988760662 5:34306867-34306889 CCCAGATGGGGTGGCTGCTGGGC 0: 41
1: 430
2: 1406
3: 4350
4: 4592
Right 988760671 5:34306906-34306928 TCTCAGATGGGGCAGCTGCCGGG 0: 20
1: 340
2: 723
3: 1614
4: 4108
988760663_988760671 15 Left 988760663 5:34306868-34306890 CCAGATGGGGTGGCTGCTGGGCG 0: 44
1: 475
2: 1214
3: 1583
4: 2796
Right 988760671 5:34306906-34306928 TCTCAGATGGGGCAGCTGCCGGG 0: 20
1: 340
2: 723
3: 1614
4: 4108
988760659_988760671 24 Left 988760659 5:34306859-34306881 CCTCACTTCCCAGATGGGGTGGC 0: 532
1: 2666
2: 5168
3: 10303
4: 6855
Right 988760671 5:34306906-34306928 TCTCAGATGGGGCAGCTGCCGGG 0: 20
1: 340
2: 723
3: 1614
4: 4108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988760671 Original CRISPR TCTCAGATGGGGCAGCTGCC GGG Intergenic
Too many off-targets to display for this crispr