ID: 988766409

View in Genome Browser
Species Human (GRCh38)
Location 5:34382266-34382288
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 768
Summary {0: 6, 1: 192, 2: 177, 3: 141, 4: 252}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988766409_988766412 -1 Left 988766409 5:34382266-34382288 CCCTGCCATCTTTTGCAGATAAC 0: 6
1: 192
2: 177
3: 141
4: 252
Right 988766412 5:34382288-34382310 CTACTCTCTTTTTGAGAGACAGG No data
988766409_988766413 5 Left 988766409 5:34382266-34382288 CCCTGCCATCTTTTGCAGATAAC 0: 6
1: 192
2: 177
3: 141
4: 252
Right 988766413 5:34382294-34382316 TCTTTTTGAGAGACAGGTCTTGG No data
988766409_988766414 16 Left 988766409 5:34382266-34382288 CCCTGCCATCTTTTGCAGATAAC 0: 6
1: 192
2: 177
3: 141
4: 252
Right 988766414 5:34382305-34382327 GACAGGTCTTGGCCTATTACTGG No data
988766409_988766417 26 Left 988766409 5:34382266-34382288 CCCTGCCATCTTTTGCAGATAAC 0: 6
1: 192
2: 177
3: 141
4: 252
Right 988766417 5:34382315-34382337 GGCCTATTACTGGGCTTTGGTGG 0: 13
1: 161
2: 162
3: 88
4: 160
988766409_988766416 23 Left 988766409 5:34382266-34382288 CCCTGCCATCTTTTGCAGATAAC 0: 6
1: 192
2: 177
3: 141
4: 252
Right 988766416 5:34382312-34382334 CTTGGCCTATTACTGGGCTTTGG 0: 17
1: 191
2: 171
3: 92
4: 154
988766409_988766415 17 Left 988766409 5:34382266-34382288 CCCTGCCATCTTTTGCAGATAAC 0: 6
1: 192
2: 177
3: 141
4: 252
Right 988766415 5:34382306-34382328 ACAGGTCTTGGCCTATTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988766409 Original CRISPR GTTATCTGCAAAAGATGGCA GGG (reversed) Intergenic
900434957 1:2625575-2625597 GTTAACTGCAGAAGATAGCAGGG - Intronic
901904053 1:12392687-12392709 GTTATCTGCAGAAGATGGCAGGG + Intronic
902802465 1:18838993-18839015 GTTATCTCTAAAGGATGGCCAGG - Intergenic
904179495 1:28655974-28655996 GTTATCTGCAGAAGATGGCAGGG + Intergenic
904335930 1:29797983-29798005 GTTATCTGCAGAAGATGGCAGGG - Intergenic
904889388 1:33767561-33767583 GTTAGCTGCATAAGAGGGTATGG - Intronic
905354065 1:37368784-37368806 GTTATCTGCAGAAGATGGCAGGG - Intergenic
905465223 1:38148096-38148118 GTTATCTGAAGAAGATGGTAGGG - Intergenic
905877145 1:41439428-41439450 GTTATTTGCCAAAGAAGCCATGG - Intergenic
906050486 1:42867411-42867433 ATTATCTGCAGAAGATGGCAGGG - Intergenic
906879673 1:49576459-49576481 GTTATGTGCAGAAAATGGCAGGG - Intronic
906927056 1:50128961-50128983 GTAAACTGCAAGTGATGGCAAGG + Intronic
907597344 1:55732127-55732149 GTTATCTGCAGAAGATGACAGGG - Intergenic
907602085 1:55782150-55782172 GTTATCTGTAGATGATGGCAGGG + Intergenic
908805654 1:67928701-67928723 GTTATTTGCCAAAGATCACATGG + Intergenic
908964456 1:69741253-69741275 GATATGTTCAAAATATGGCATGG + Intronic
909576918 1:77185855-77185877 GTTATCTGCAGAAGATGGCAGGG - Intronic
909706592 1:78592189-78592211 GTCATCTGCAGAAGAAGGAATGG + Intergenic
909774070 1:79462352-79462374 GCTATCTACCAAAGATTGCATGG - Intergenic
910242336 1:85100850-85100872 GTTCTCAGCAAACTATGGCAAGG + Intronic
910370632 1:86512125-86512147 GTTATCTGCAGAAGATGGCAGGG - Intergenic
910561898 1:88599978-88600000 GTTATCTGCAGAAGATGGCAGGG - Intergenic
910565675 1:88640075-88640097 GTTATCTGAGAATGATGGCAGGG + Intergenic
910588214 1:88901723-88901745 ATTATCTGCAGAAGATGGCAGGG - Intergenic
910630218 1:89346249-89346271 GTTATCTGCAAAAGATGGCAGGG - Intergenic
910638993 1:89439977-89439999 ATTATCTGCAGAAGATGGCAGGG + Intergenic
910831100 1:91463427-91463449 GTTGTCTGCAAAAGATGGCAGGG + Intergenic
910948212 1:92616685-92616707 GTTATCTGAAGAAGATGGCAGGG - Intronic
911109100 1:94164208-94164230 GTTATCTTCAGAAGATGGCAGGG + Intronic
911143430 1:94530201-94530223 GTTATGTGCAAAAGGTGCCATGG + Exonic
911204511 1:95078929-95078951 AATATCTTCAAAAGATGGAATGG + Intergenic
911221620 1:95253207-95253229 ATTATTTGCAGAAGAGGGCATGG + Intergenic
911257328 1:95647367-95647389 GTTATCTGCAGAAGATGGCAGGG + Intergenic
911417875 1:97598587-97598609 GTTCTCTGAAAAAGAAGGGAGGG + Intronic
911738400 1:101361922-101361944 GTTATCTGCAGAAGATGGCAGGG + Intergenic
911883568 1:103270446-103270468 GTTATAGGCAGAAGATGGCAGGG - Intergenic
911980424 1:104559418-104559440 GTTATCTGCAGAAGATGGCAGGG - Intergenic
911981901 1:104579265-104579287 GTTATCTGCAAAGTATGGCAGGG + Intergenic
912067020 1:105756944-105756966 GTTATATGCAGAAGAAGGCAGGG - Intergenic
912129914 1:106588053-106588075 GTTATCTGCAGAAGATGGCAGGG + Intergenic
912212250 1:107568891-107568913 GTTATCTGCAGAAGATGGCAGGG - Intergenic
912252032 1:108021391-108021413 GTTATCTGCAGAAGATGGCAGGG + Intergenic
912733325 1:112128832-112128854 GTCATCTGCAGAAGATGGCAGGG + Intergenic
913039447 1:115008398-115008420 GTTATCTACAGAAGATAGCAGGG + Intergenic
915625079 1:157109493-157109515 GTTAGCTGCAGAAGATGCCAAGG + Intergenic
915662794 1:157417676-157417698 AAAATCTGCAAAAGATGCCATGG - Intergenic
915667672 1:157459646-157459668 GTCATCTGCCAAAGATGGCAAGG + Intergenic
915685499 1:157628089-157628111 GTTATCTACAAAAGAATGAAAGG + Intergenic
915908320 1:159896032-159896054 GTGATCTGGAAAACATGGAATGG - Intronic
916106332 1:161435330-161435352 GTTATTTGCAGAAGATGGCAGGG + Intergenic
916285314 1:163099525-163099547 GTTATTTGCAGAAGATCGGAGGG - Intergenic
916709175 1:167387103-167387125 GTTCTCTGCATATGGTGGCAGGG + Intronic
917217217 1:172690916-172690938 GTTATCTGCAGAAGATGGCAGGG + Intergenic
917233880 1:172869087-172869109 ATTTTCAGCAAAAGATGCCAAGG + Intergenic
918755718 1:188337812-188337834 GTTATCTGGAGAAGATGGAAGGG + Intergenic
918815076 1:189171225-189171247 GTTACCTGCAGAAGATGGCTGGG - Intergenic
918918234 1:190671882-190671904 GTTATCTGCAGAAGATGGCAGGG + Intergenic
918958241 1:191237946-191237968 GTTGTCTTCAGAAGATGGCAGGG - Intergenic
919124614 1:193379784-193379806 GTTATCTACAGAAGATGGCAGGG + Intergenic
919220455 1:194621688-194621710 GTTATCTGCAGAAGTGTGCATGG + Intergenic
920197428 1:204238363-204238385 GTTAGCTGCAGAAGATGGCAGGG - Intronic
920305854 1:205017662-205017684 GATATCTGCTAGAGATGGAAGGG - Exonic
921353961 1:214267000-214267022 TATATATGTAAAAGATGGCATGG + Intergenic
922015427 1:221641175-221641197 GTCATCTGGAAAAGATGGGCAGG + Intergenic
922781049 1:228252584-228252606 GTTATCTGCAGAAGATGACAGGG + Intronic
923068667 1:230543180-230543202 GTTCTCTGCTACAGGTGGCATGG - Intergenic
923208720 1:231783691-231783713 GGGACCTGCAAGAGATGGCACGG + Intronic
923253571 1:232199440-232199462 GTTATCTGCAGAAGATAGCAGGG + Intergenic
923303991 1:232671429-232671451 ATTAGCTGCAAAATATGCCATGG + Intergenic
924182509 1:241453248-241453270 GTTATTTGCAGAAGATAGCAGGG + Intergenic
924840779 1:247707835-247707857 GTTATCTGCAGAAGATGGCAGGG + Intergenic
924847136 1:247785141-247785163 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1064517645 10:16168259-16168281 GTTATCTGCAGAAGAGGGCAGGG + Intergenic
1064545691 10:16448138-16448160 GTTATCTGCAGAAGATGGCAGGG + Intronic
1065005323 10:21374161-21374183 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1066167030 10:32799233-32799255 ATTATCTGCAGAAGACGGCAGGG + Intronic
1067026696 10:42848357-42848379 GTTATCTGCTGAGGATGGCAGGG + Intergenic
1067125556 10:43512547-43512569 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1067333137 10:45340214-45340236 GTTATATGCAGAAAATGGCAGGG - Intergenic
1068007720 10:51409879-51409901 GTTATCTGCAGAAGATGTCAGGG + Intronic
1068447207 10:57138590-57138612 GTTATCTGAAGAAGATGGCAGGG - Intergenic
1069145759 10:64890436-64890458 TTTATCTGCGGAAGATGGTAGGG - Intergenic
1069790834 10:71019586-71019608 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1070869640 10:79739289-79739311 GTTTTCTGCAAAAGAGTACATGG + Intergenic
1071267089 10:83974005-83974027 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1071364471 10:84884524-84884546 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1071636558 10:87261498-87261520 GTTTTCTGCAAAAGAGTACATGG + Intergenic
1071658686 10:87476451-87476473 GTTTTCTGCAAAAGAGTACATGG - Intergenic
1071673930 10:87637432-87637454 GTTATCTTCAGAAGATGGTAGGG + Intergenic
1071937686 10:90549273-90549295 GTTATCTGCAGAAGATGGAAGGG - Intergenic
1071942788 10:90607781-90607803 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1072209260 10:93231681-93231703 GTTATCTACAGAAGATGGCAAGG + Intergenic
1073189832 10:101643425-101643447 CTTCTCAGCAAAGGATGGCAAGG - Intronic
1073656682 10:105424486-105424508 GTTATCTGCAGAAGATGTCAGGG + Intergenic
1073830507 10:107378012-107378034 GTTATCTGTAGATGATGGCAGGG + Intergenic
1073918479 10:108432318-108432340 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1073957687 10:108891656-108891678 GTTATCTGCAGAAGATGGTAGGG + Intergenic
1075606786 10:123817396-123817418 ATTATTTGCAGAAGATGGCAGGG - Intronic
1075767458 10:124905019-124905041 GTTATTTCCAAATGATGGAAGGG - Intergenic
1076600617 10:131654769-131654791 GTTTGCTGAAAATGATGGCAGGG + Intergenic
1076772632 10:132674842-132674864 GTTACCTGCAGAAGATGGCAGGG + Intronic
1076927418 10:133499229-133499251 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1078969244 11:16388079-16388101 TTTATCTGAAAAGGATGGCTAGG - Intronic
1079508298 11:21180102-21180124 TTTGTCTGCAAACTATGGCATGG - Intronic
1079515944 11:21268744-21268766 GTTATCAAGAAAAAATGGCAAGG + Intronic
1080076589 11:28157492-28157514 GTTATCTGCAGAAGATGTCAGGG - Intronic
1080976677 11:37350569-37350591 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1081065465 11:38534905-38534927 GTTGTCTGCAGGAGATGGCAGGG + Intergenic
1081072773 11:38631092-38631114 GATGTCTGCAGAAGATGGCAGGG - Intergenic
1081110474 11:39128390-39128412 GTTATCTGCATAAGATGGCAGGG - Intergenic
1081134966 11:39429233-39429255 GTTTTCAGCAAAAGACAGCAAGG + Intergenic
1081304770 11:41498320-41498342 GTTATCTGCCAGAGATTCCATGG - Intergenic
1081609058 11:44547849-44547871 GTTATCTGTAGAAGATGGCAGGG - Intergenic
1082671697 11:56043013-56043035 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1082999657 11:59279853-59279875 AGTATCTGCAGAAGATGGCAGGG - Intergenic
1083093142 11:60221098-60221120 GTTATCTGCAGAAGATGGCAGGG - Intronic
1083112259 11:60422850-60422872 GTTATCTGAAGAGGATGGAAGGG + Intergenic
1085035182 11:73295712-73295734 GTTATCTGTAAAATAGGGGAAGG - Exonic
1085685959 11:78622161-78622183 CTTATCTGCAGAAGATGGCAGGG - Intergenic
1085747568 11:79128211-79128233 GTTATCTGCAGAAGATGCCAGGG - Intronic
1086399727 11:86450553-86450575 GTTATCTGCAAAAGAGAGCATGG - Intronic
1086834111 11:91600364-91600386 GTTATCTGCAGAAGATGGCAAGG - Intergenic
1087117388 11:94540425-94540447 GTTACCTGAAAAAGAGGGAAAGG - Intergenic
1087153257 11:94877521-94877543 GTAATGTGCAAAAGATGGCAGGG + Intergenic
1087443486 11:98216650-98216672 GTTATTTGCAAAAGAAATCAAGG - Intergenic
1088002160 11:104895526-104895548 GTTAACTGTAATAGATGGCCAGG + Intergenic
1088191663 11:107234519-107234541 GTTATCTGCAGAATATGGCAGGG + Intergenic
1088449351 11:109965339-109965361 GTTATCTGTGGAAGATGGCAGGG - Intergenic
1088498715 11:110459955-110459977 GTTATCAGTGAAACATGGCAGGG - Intronic
1088836652 11:113583360-113583382 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1089343621 11:117776426-117776448 CTTACCTGCGAAAGGTGGCAAGG - Intronic
1089390697 11:118099685-118099707 GCAATCTGCAGAAGATGGGAAGG - Intronic
1089449821 11:118585832-118585854 TTAAACTGCAAAAGATGGCTGGG - Intronic
1090209496 11:124908076-124908098 GTCATCTGCAGAAGATGGCAGGG + Intergenic
1090221618 11:125031614-125031636 GTTATCTGCAGAAGATGGCAGGG + Intronic
1091564122 12:1635526-1635548 GTCATTTGAAAAAGATGGAATGG + Intronic
1092012419 12:5125630-5125652 GCTATCTGCAAAAAAAGGCAGGG + Intergenic
1092093280 12:5821622-5821644 GTTATCTGCAGAAGATGGCAGGG - Intronic
1092381557 12:8000910-8000932 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1093031874 12:14295978-14296000 GTTATCTGCGGAAGATGGCAGGG + Intergenic
1093036285 12:14335314-14335336 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1093048927 12:14484996-14485018 GTTACCTGCAAAAGATGGCAGGG + Intronic
1093049673 12:14490991-14491013 GTTACCTGCAAAAGATGACAGGG + Intronic
1093341119 12:17975016-17975038 GTTATCTGCAACAGAGGGCATGG + Intergenic
1093645724 12:21583642-21583664 GTTATCTGCAGAAGATGGCAGGG - Intronic
1093964535 12:25310928-25310950 GTTATCTGCAGAAGACGGCAGGG - Intergenic
1094102525 12:26779234-26779256 GTTATCTGCAGAAGATGGCAGGG - Intronic
1094819395 12:34212698-34212720 GTTATCTGCAGATAATGGCAGGG - Intergenic
1095095415 12:38145376-38145398 GTTATCTGCAGATAATGGCAGGG + Intergenic
1095121509 12:38424872-38424894 GTTTTCTGCAGAAAATGCCAGGG + Intergenic
1095844403 12:46729996-46730018 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1095856244 12:46863703-46863725 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1096173054 12:49489447-49489469 TTTATCTGGAAAAGATGACAGGG - Exonic
1096288709 12:50322932-50322954 GTTATCTACAGAAGATGGCAGGG - Intergenic
1096457473 12:51799465-51799487 GTTATCTGCAGAAGATGGCAGGG + Intronic
1097076997 12:56402413-56402435 GTTATCGCCAGAAGATGGCAGGG - Intergenic
1097437844 12:59572282-59572304 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1097556459 12:61145032-61145054 GTTAACTGCAAAAGAGGGAATGG + Intergenic
1097821386 12:64132192-64132214 GTTATCTGCAGAAGAAGGCAGGG + Intronic
1098231590 12:68376599-68376621 GTTTTCTAAAAAAGATGGCAAGG + Intergenic
1098673037 12:73254216-73254238 GTTAACTGCAGAAGATGGCAGGG - Intergenic
1098716087 12:73829787-73829809 GTTATCTGCAAAAGATGGCAAGG - Intergenic
1098731048 12:74037320-74037342 GTTATCTGCAGAAGATAGCAGGG - Intergenic
1098733287 12:74065603-74065625 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1098749844 12:74279563-74279585 GTTATCTGCAGAAGATGACAGGG - Intergenic
1098831908 12:75374053-75374075 GTTATCTGCGGAAGATAGCAGGG + Intronic
1099183383 12:79492616-79492638 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1099365920 12:81765356-81765378 GTTATCTGCAGAATATGGCAGGG - Intergenic
1099379385 12:81936568-81936590 GTTATCTGCAGAAGATGGCATGG + Intergenic
1099526359 12:83723083-83723105 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1099689777 12:85938009-85938031 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1099821352 12:87715108-87715130 GTCATCTGCAAAGAATGGCAGGG + Intergenic
1099995070 12:89769558-89769580 GTTATCTGAAGAGGATGGCAGGG + Intergenic
1100241156 12:92711636-92711658 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1101222653 12:102657369-102657391 GTTATCTGCAGAGGATGGAAAGG - Intergenic
1101264128 12:103066094-103066116 GTTATCTGCAGAAGATGACAGGG - Intergenic
1101534671 12:105606132-105606154 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1101539526 12:105652455-105652477 ATTATCTGCTGCAGATGGCATGG - Intergenic
1101543068 12:105682608-105682630 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1103035608 12:117654035-117654057 GTTATCTGCAGAAGATGGCAGGG - Intronic
1105341879 13:19534492-19534514 GTTAACTGCAAAAGAAAGGAAGG - Intronic
1105740105 13:23315148-23315170 GTTATCTTCAGAAGATGGCAGGG - Intronic
1106054797 13:26228204-26228226 GTTCTCTGCAGCAGATGGCATGG + Intergenic
1107492718 13:40897025-40897047 TTTAAATGCAAAAAATGGCAAGG + Intergenic
1107505166 13:41026590-41026612 ATTATCTGCAGTTGATGGCAAGG - Intronic
1107678766 13:42825391-42825413 ATCATCTGCAAGAGTTGGCATGG + Intergenic
1107942141 13:45384136-45384158 GTTATTTGCAAAAGATAACATGG + Intergenic
1107983579 13:45756000-45756022 GTTATCTGCAGAAGATGACAGGG + Intergenic
1108302440 13:49092013-49092035 GTTATCTGCGGAAGATGGCAGGG + Intronic
1108827607 13:54433858-54433880 TTTATTTGCAAGAGATGTCATGG - Intergenic
1108904274 13:55449943-55449965 GTTATTTGCAGAAGATGGCAGGG - Intergenic
1108914306 13:55588899-55588921 CTTATCTGCAGGAGATGGCAGGG + Intergenic
1109293220 13:60500090-60500112 GTTATCCACAGAAGATGGCAGGG - Intronic
1109712684 13:66180850-66180872 GTTTTCTACAGAAGATGGCAGGG + Intergenic
1109951027 13:69502233-69502255 GTTATCTGCAGAAGATAGCAGGG + Intergenic
1110194569 13:72772708-72772730 GTTTTCTGCCAAAGATGCCCTGG - Exonic
1110590494 13:77251542-77251564 CATTTCTGCAAAAGAAGGCAAGG + Intronic
1110834139 13:80064657-80064679 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1111317498 13:86581775-86581797 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1111842068 13:93462009-93462031 AGTATCTACATAAGATGGCATGG - Intronic
1112231130 13:97590192-97590214 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1112249932 13:97770306-97770328 ATTATCTGCAGAAGATGGCAGGG + Intergenic
1112561608 13:100520312-100520334 GTTATCTGGAAAAGATTAAAAGG - Intronic
1113111598 13:106829597-106829619 GTTATCTGCTGATGATGGCAAGG + Intergenic
1113319709 13:109221691-109221713 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1114033639 14:18598912-18598934 TTTATCTGCAAAAGAGAGTAGGG + Intergenic
1114078430 14:19178092-19178114 TTTATCTGCAAAAGAGAGTAGGG + Intergenic
1114125060 14:19716437-19716459 TTTATCTGCAAAAGAGAGTAGGG - Intergenic
1114205867 14:20570741-20570763 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1114396697 14:22370140-22370162 GTTATCTGCAGAGTATGGCATGG + Intergenic
1114905379 14:27120450-27120472 GCTATCTGAAGAAGATGGCAGGG + Intergenic
1115059713 14:29173866-29173888 GTTATCTGCAGAAGATGACAGGG - Intergenic
1115143395 14:30199359-30199381 GTTATCTCCAGAAGATAACAGGG - Intergenic
1116058904 14:39896910-39896932 GTTATCTGTAGAATATGGCAGGG - Intergenic
1116068090 14:40009143-40009165 GTTATCTGAAGAAGATGGGAGGG - Intergenic
1116308049 14:43283475-43283497 GTTATCTGCAGAAGATGGTAGGG + Intergenic
1116415068 14:44669284-44669306 GTTATTTGCAGAAGATGGCAGGG - Intergenic
1116660933 14:47709457-47709479 GTTATCTGCCAAAGAGGGCATGG - Intergenic
1116999512 14:51357927-51357949 GGTATCTGCAAAAGAGATCATGG - Intergenic
1117001596 14:51376284-51376306 GTTATCTGCAGAAGATCACAGGG - Intergenic
1117089169 14:52232787-52232809 GATATCTCCAAAAAATGGAATGG - Intergenic
1117216839 14:53560147-53560169 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1117634129 14:57724345-57724367 GTTATCTGCAGAAGATGGCAGGG - Intronic
1118122437 14:62860198-62860220 GTTATCTGCAGAAGACGGCAGGG + Intronic
1118880778 14:69824046-69824068 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1118988927 14:70780591-70780613 TTAATTTGCACAAGATGGCAAGG - Intronic
1119107567 14:71938867-71938889 GTTACCTGCAGAAGATGACAGGG + Intronic
1120082028 14:80227558-80227580 GTTATCTGCAGAAGATGGCAGGG + Intronic
1120169403 14:81233958-81233980 GTTATCTGCAGAAAATGGCAGGG - Intergenic
1120175955 14:81293502-81293524 GTTATCTCCCACAGATGGCCAGG - Intronic
1120250744 14:82059677-82059699 ATTATCTGCAAATGATGGCAGGG + Intergenic
1120555998 14:85930473-85930495 GTTATCTGCATAAGATGGCAGGG + Intergenic
1123152025 14:106191289-106191311 GGGAACTGCAAAAGAGGGCAAGG - Intergenic
1123400412 15:19979115-19979137 GGGAACTGCAAAAGAGGGCAAGG - Intergenic
1123817818 15:23997530-23997552 GTTATCTGTGGATGATGGCAGGG + Intergenic
1125185067 15:36920634-36920656 GTTATCTGCCAAAGGAAGCATGG - Intronic
1126283606 15:46986249-46986271 GTTGTCTGCAGAAGATGGCAGGG - Intergenic
1127356910 15:58209161-58209183 GTTATCTGCAGAAGATGGCAGGG - Intronic
1127661746 15:61105974-61105996 TTTATCTTCATAAGCTGGCAAGG + Intronic
1128822138 15:70666858-70666880 AATATCTGCAAAAGATGAGAAGG - Exonic
1129973690 15:79803230-79803252 GTTTGCTGCATAAGATAGCAAGG - Intergenic
1131724006 15:95202767-95202789 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1132286820 15:100669467-100669489 GCTTTCTGCAAGAGATGGCTCGG + Intergenic
1132305743 15:100810892-100810914 GTTATTTGCAGAGGATAGCAAGG + Intergenic
1135476690 16:22782678-22782700 GTGAAATGTAAAAGATGGCAGGG + Intergenic
1136250937 16:29004563-29004585 GTTATCTGCAGAAGATGGCGGGG - Intergenic
1138868381 16:60850757-60850779 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1139188863 16:64838477-64838499 ATTTTCTGCAACAGATGACATGG + Intergenic
1141559547 16:84858066-84858088 GTTATCTGCAGAAGATGGCAGGG + Intronic
1143050119 17:4118378-4118400 GTTATCTGCAAAAGATAGTAGGG + Intronic
1143273247 17:5690921-5690943 GATATCAGCAAAAGAGGGCCCGG - Intergenic
1145366148 17:22268448-22268470 GGTGTCAGCAAAAGATGGCCGGG - Intergenic
1145839034 17:27978231-27978253 GATGCCTGCAACAGATGGCATGG - Intergenic
1146237980 17:31185920-31185942 GTTATCTGCAGAAGATGGCAGGG - Intronic
1146836351 17:36113972-36113994 GTTATCTGAACAAGATGGCAGGG - Intergenic
1146850930 17:36221012-36221034 GTTATCTGAACTAGATGGCAGGG - Intronic
1146974394 17:37098475-37098497 GTTATCTGCCAAACTTGGCAAGG + Intronic
1151037815 17:70821616-70821638 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1151353089 17:73543050-73543072 CTCATCTGCAAAAGAGGGGATGG + Intronic
1151594624 17:75069862-75069884 GTTACTTGCAAAAGAGGACATGG + Intergenic
1151890893 17:76949793-76949815 CTTGTCTGCAAAAAATGCCAGGG - Exonic
1153089703 18:1330130-1330152 GTTAACTGCAGAAGATGGCAGGG - Intergenic
1153131279 18:1857741-1857763 GTTATCTGTAGAAGATGGCAGGG + Intergenic
1153217697 18:2835634-2835656 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1154068460 18:11131067-11131089 GTTATCTGCAGAAGGTGGCAGGG - Intronic
1154252675 18:12757307-12757329 GTTACCTGCAGAAGATGGCAGGG + Intergenic
1154366973 18:13720143-13720165 GTTACCTGCAAAGGATGGAAAGG + Intronic
1154506168 18:15042858-15042880 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1154947573 18:21177290-21177312 GTTATCTACAAAAGAGCACAAGG + Intergenic
1155300457 18:24424607-24424629 GTAATCTGTAGAAGATGGCCTGG + Intergenic
1155940703 18:31799566-31799588 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1156303858 18:35858662-35858684 GTTATCTGCAGAAGATAGCATGG - Intergenic
1156606367 18:38671733-38671755 GTTATCTTCAGAAGATGGCAGGG - Intergenic
1156990308 18:43400807-43400829 GTTATCTGCAGAAGACGGCAGGG + Intergenic
1157341197 18:46779995-46780017 GTTATCTGGAGAAGATGGCAGGG - Intergenic
1157353875 18:46916242-46916264 GTTTTCCGCAAGAGATGGGATGG - Intronic
1157520233 18:48340509-48340531 GCTATGTGCAGAAGATGCCATGG + Intronic
1157870935 18:51229613-51229635 GTTACCTGCAGAAGATGGTAAGG + Intergenic
1159277136 18:66235493-66235515 GTTATCTGTGAATGCTGGCAGGG - Intergenic
1159287786 18:66375450-66375472 GTTATCTGCAGAAGATAGCAGGG - Intergenic
1159559109 18:69975383-69975405 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1159805517 18:72952988-72953010 GTAATTAGCAAAATATGGCAAGG + Intergenic
1159973544 18:74682131-74682153 GTTTTCTGACAAAGATGGAAAGG + Intronic
1162266616 19:9580826-9580848 TTAATCTGCACAAGAGGGCATGG - Intronic
1162277835 19:9671791-9671813 TTAATCTGCACAAGAGGGCATGG - Intronic
1162285001 19:9731652-9731674 GTTTCCTGCAGAAGATGGCATGG - Intergenic
1162803698 19:13125301-13125323 GGTATCTGCACAGGGTGGCAAGG + Intronic
1163866394 19:19776753-19776775 GTTACCTGCAAGTGATCGCAGGG - Intergenic
1164097090 19:22021375-22021397 GTTATCTGCAGAAAATGGCAGGG + Intergenic
1164117262 19:22234606-22234628 GTTATCTGCAGAAAATGGCAGGG + Intergenic
1166377643 19:42336617-42336639 GTTACCTGCATAAGCTAGCAAGG - Intronic
1167394111 19:49216344-49216366 GTTGTGTGCAGAAGATGGCATGG - Intergenic
1167700740 19:51043687-51043709 GCCATCTGCAAAAAATGGGATGG - Intergenic
1168539340 19:57197402-57197424 GTTATCTGCAGAAGATGGCAGGG + Intronic
925499411 2:4486953-4486975 ATAATCTGCAGAAAATGGCAGGG + Intergenic
926810400 2:16750707-16750729 AGTATCTGCAGAAGATGGCAGGG + Intergenic
926825570 2:16902262-16902284 GTTATCTGCAGAAGATGGCAGGG + Intergenic
926826758 2:16913637-16913659 AGTATCTGCAGAAGGTGGCATGG - Intergenic
927008713 2:18879692-18879714 CTTATCTGCAGAAGATGGCAGGG - Intergenic
928913192 2:36443487-36443509 TTGACCTGCAAAAGATGGAAGGG - Intronic
930152428 2:48072177-48072199 GTTATGTGCATGAGATGCCAAGG + Intergenic
930295408 2:49547541-49547563 GTTACCTGCAGAAGATGGCAGGG + Intergenic
930910147 2:56620867-56620889 GTTATCTGCAGAAGATGCCAGGG - Intergenic
931987158 2:67753413-67753435 GTTGTCAGCAAATGATGGTAGGG + Intergenic
932609421 2:73187765-73187787 GGAAGCTGCATAAGATGGCAAGG - Intergenic
933265688 2:80178413-80178435 GTTATCTGCAGAAGATGACAGGG + Intronic
935183931 2:100714869-100714891 GTTATTTTCAGAAGATGGTAGGG - Intergenic
935425114 2:102911357-102911379 GTTATTTGCAGAAGATGGCAGGG + Intergenic
935542135 2:104361162-104361184 GTTATTGCCAAAAGATGCCAAGG + Intergenic
935564313 2:104590283-104590305 GTTATCTGCAGAAGATGGCAGGG + Intergenic
936641220 2:114314660-114314682 GTTATCTGGACAAGATGGGAGGG - Intergenic
937582067 2:123499197-123499219 GTTCTCTGCAGAAGAAGACAGGG + Intergenic
937800323 2:126074698-126074720 CTTATCTGAAGAAGATGGCAGGG - Intergenic
937852574 2:126648768-126648790 GCTATCTGCAGGAGATGACAGGG + Intergenic
938139288 2:128783156-128783178 GTTCCCTGGGAAAGATGGCATGG - Intergenic
938709574 2:133964606-133964628 GTTATCTGCAGAGGATAGCATGG - Intergenic
938897103 2:135763305-135763327 ATACCCTGCAAAAGATGGCAGGG - Intronic
939069057 2:137517826-137517848 GTTATCTGCAGAAGATGGCAGGG - Intronic
939213868 2:139212210-139212232 GTTATCTGCAGAAGATGGCAGGG - Intergenic
939633369 2:144551813-144551835 GTTATCTGCAGATGATGGCAGGG + Intergenic
939755228 2:146101774-146101796 GTTATCTGCAGAGGAAGGCAGGG - Intergenic
939788689 2:146546143-146546165 GTTATCTGCAGAAGATGCCAGGG + Intergenic
939806236 2:146778444-146778466 GTTATCTGCAGAAGATGGCAGGG - Intergenic
940171316 2:150832742-150832764 GTTATCTGCAGAAGTTGATAGGG + Intergenic
940472092 2:154113157-154113179 GTTATCTGCAGAAGATGGCATGG + Intronic
940571126 2:155435608-155435630 GTTTTCTGCAAAAGGTTGTAAGG + Intergenic
941039492 2:160604687-160604709 GTGGTCTGAAAAAGAGGGCAAGG - Intergenic
941330672 2:164174595-164174617 CTTATCTGACAAAGATGGCAGGG + Intergenic
941668013 2:168261100-168261122 GTTATCTGCAGAAGATGGCAGGG - Intergenic
942022197 2:171877159-171877181 ATTGTCTATAAAAGATGGCAGGG + Intronic
942055406 2:172177803-172177825 GTTATCTGCAAAATCTGCTAGGG - Intergenic
942321942 2:174743516-174743538 CTTATCTGCAGATGATGGCAGGG - Intergenic
943006892 2:182395811-182395833 GTTATCTGGAGAAGATGGCAGGG - Intronic
943239223 2:185362602-185362624 GTTATCTGCAGAAGATGGCAGGG + Intergenic
943384067 2:187181120-187181142 GCTATCTGTGGAAGATGGCAGGG + Intergenic
943388125 2:187227106-187227128 GTTATCTGCAGAAGATGGTAGGG - Intergenic
943517602 2:188907272-188907294 GTTATCTGCAGAAGATGGCAGGG + Intergenic
945544866 2:211138127-211138149 GTTATCTGCAGAAGATGGCAGGG - Intergenic
945642174 2:212443807-212443829 CTTATCTGCAGAACATGGCAGGG - Intronic
945717839 2:213380699-213380721 GTTATCTGCAGAAGATGGCAGGG + Intronic
945725849 2:213471525-213471547 GTTATCTGCAGAAGATGGCAGGG + Intronic
946278912 2:218651956-218651978 GTTCTCTGCTGAAGATCGCAAGG - Intronic
946527872 2:220539997-220540019 GTTATCTGCAGAAGATGGCAGGG + Intergenic
946551726 2:220808739-220808761 GTTATCTCAAAAAAATAGCAGGG - Intergenic
946703778 2:222437822-222437844 GTTATCTGCAGAAAATGGTAGGG + Intronic
946790917 2:223299730-223299752 GTTATCTGCAAATGATGGCAGGG - Intergenic
947440719 2:230118696-230118718 GTTATCTGCAGAAGATGGCAGGG + Intergenic
947440842 2:230120227-230120249 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1170092313 20:12604141-12604163 GGTATCTGCAGAGGATGACAGGG + Intergenic
1170349850 20:15426777-15426799 GTTATGTGCAACACCTGGCATGG + Intronic
1171315862 20:24194185-24194207 GTTATCCACAAAGGATGGCCAGG - Intergenic
1171335667 20:24383179-24383201 GTCATTTGCTAAAGATGTCAGGG - Intergenic
1173174185 20:40751917-40751939 GTTATCTGAATAAGCTTGCATGG + Intergenic
1175039010 20:56027906-56027928 ATTATCTGCTACAGATGGCATGG + Intergenic
1175378920 20:58549175-58549197 GTGATCTGCAAATGATGGGAGGG - Intergenic
1176791685 21:13326166-13326188 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1176870520 21:14080128-14080150 GTTATCTGCAGATAATGGCAGGG - Intergenic
1176998156 21:15580154-15580176 GTTATCTGCAGAAGACGGCAGGG - Intergenic
1177139422 21:17342299-17342321 GTTATCTGCAGGAGACGGCAGGG + Intergenic
1177430304 21:20983709-20983731 GTTCTCTGAAAAAGTTGGCATGG - Intergenic
1177505565 21:22014212-22014234 GTTATCTGCAGAAGATGGAAGGG + Intergenic
1177913171 21:27056180-27056202 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1177933701 21:27316963-27316985 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1177991075 21:28037168-28037190 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1178012656 21:28305145-28305167 GTTATCAGCAGAAGATGGCAGGG - Intergenic
1178060759 21:28851168-28851190 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1179415154 21:41192551-41192573 GTTATCTGAAGAAGATGGCAGGG + Intronic
1179528319 21:41999056-41999078 GATCTCTGTAAAAGATGGTAAGG - Intronic
1180457755 22:15525956-15525978 TTTATCTGCAAAAGAGAGTAGGG + Intergenic
1180591151 22:16938397-16938419 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1181367440 22:22388974-22388996 GCTACCTGCAGAAGATGGCAGGG + Intergenic
1181420649 22:22795801-22795823 GTTATCTGTAGAGGATGGCAGGG - Intronic
1184603565 22:45558405-45558427 GTTATCTGCAGAAGATGGCAGGG + Intronic
1185075993 22:48682573-48682595 GTTATATGCAAATGACGTCAGGG - Intronic
949125668 3:443176-443198 GTTATCTGCAGAAGATGGCAGGG + Intergenic
949245862 3:1924892-1924914 GTTATCTGCAGAAGGTGGCGGGG - Intergenic
949417596 3:3830913-3830935 GTTATCTGCAGAAGATGGCAGGG + Intronic
949445607 3:4131023-4131045 GTTATCTGCAGAAGATGGCAGGG - Intronic
949638776 3:6012486-6012508 GTTATCTGCAAAAGATGGCAGGG - Intergenic
950882204 3:16331482-16331504 GTTATATAAAAAAGAAGGCATGG - Intronic
951003615 3:17592821-17592843 GTTATCTACAGAAGATGGCAGGG - Intronic
951122566 3:18945536-18945558 GTTATCTGCAGAAGATGGCAGGG - Intergenic
951291522 3:20876776-20876798 GTTATCTGCACAAGACAGCAGGG + Intergenic
951970767 3:28441896-28441918 GTTATCTGCAGAAGATGGCAGGG + Intronic
952369621 3:32709001-32709023 GTTATCTTCAAAATTTGGGAAGG - Intronic
952573683 3:34748257-34748279 GAAACCTCCAAAAGATGGCATGG + Intergenic
954054114 3:48007646-48007668 GTTATCTGTAGAAGATGGCAGGG - Intronic
955035580 3:55264061-55264083 GTTATCTGCAGAGGATGGCAGGG - Intergenic
955063198 3:55512036-55512058 GCTATCTGGGAAATATGGCAGGG + Intronic
956306871 3:67835591-67835613 GTTATCTGCAGAAGATGGCAGGG - Intergenic
956360448 3:68441407-68441429 GTAATCTGCAGAAGATGGCAGGG - Intronic
956509657 3:69980341-69980363 GTTATCTGCAGAAGATGGCAGGG - Intergenic
956703898 3:71982918-71982940 GTTATCTGCAGAAGATGACAGGG + Intergenic
956952441 3:74297951-74297973 GTTCTCTGCAGAAGAAGGTATGG - Exonic
957247585 3:77733928-77733950 GTTATCTGCAGAAGATGGCAGGG + Intergenic
957298503 3:78361674-78361696 GTTATCAGTAGAAGATGGCAAGG + Intergenic
957754593 3:84469395-84469417 GTTATCTGCAGAAGATGGCAGGG - Intergenic
957941845 3:87016300-87016322 GTTCTATGCAAAAGGTGGCTTGG + Intergenic
958116935 3:89232543-89232565 GATATCTCCAAAAGAAGGTATGG - Intronic
958487682 3:94732505-94732527 GTTATCTGCAGAAGATGGCAGGG + Intergenic
958762120 3:98321493-98321515 GTTATCTATGAAGGATGGCAAGG + Intergenic
958934300 3:100240597-100240619 GCTATCTGCAGAAGATAACATGG - Intergenic
959203656 3:103279276-103279298 GTTATCTGCAGAAGATGGCAGGG + Intergenic
959377349 3:105602865-105602887 GTTATCTGCGGAAGATGGTAGGG + Intergenic
959439505 3:106359151-106359173 GTTATCTGCAGAAGACGGCAGGG - Intergenic
959746018 3:109777304-109777326 GTTATCTGCAGAAGATGGCAGGG + Intergenic
959774529 3:110141129-110141151 GCCATATGCTAAAGATGGCATGG - Intergenic
959997855 3:112698291-112698313 GTTATCTGCAGAAGATGGAAGGG - Intergenic
960494750 3:118360811-118360833 GTTATCTGAAGATGATGGCAGGG + Intergenic
961262844 3:125616392-125616414 GTTATCTGCAGAAGATGGTAGGG - Intergenic
963355666 3:144206891-144206913 CTTATCTTCTGAAGATGGCAAGG + Intergenic
963630306 3:147723189-147723211 GTTATCTGCAGAAGATTACAGGG - Intergenic
963661388 3:148132114-148132136 GTTATCTGCAGAAGGTGGCAGGG - Intergenic
963983834 3:151569370-151569392 GTGATATTCAAAAGATGGAAAGG - Intergenic
964021345 3:152016077-152016099 ATTATCTGCAAATAATGACAGGG + Intergenic
964290599 3:155175943-155175965 GTTATCAGCTAAAGATTGGAGGG - Intronic
964297668 3:155251890-155251912 GTTATCTGCAGATGATGGGAGGG - Intergenic
964679250 3:159318945-159318967 GTTATCTGCAGAAGATGGCAGGG + Intronic
965237990 3:166152503-166152525 GTTACCTGCAAAAGATGATTTGG + Intergenic
965251335 3:166348298-166348320 GTTATCTGCAGAAGATTCCAGGG + Intergenic
965291745 3:166889611-166889633 GTTATATGCAGAAGATGGCAGGG + Intergenic
965708649 3:171534810-171534832 GTTATCTGCAGAGGATGGCAGGG + Intergenic
965893162 3:173540125-173540147 GTCATCTGCAGAGGATGGCAGGG + Intronic
966044334 3:175530952-175530974 GTTATCTGCAGAAGATGGCAGGG + Intronic
966445689 3:179998528-179998550 GTTATCTGCAGAAGATGGCAGGG - Intronic
966480563 3:180403935-180403957 GTTATCTGCAGAGGGTGGTAGGG - Intergenic
966661309 3:182417978-182418000 GTTATCTGCAAATGATGGCAGGG - Intergenic
968800179 4:2738090-2738112 GTTAGCTGCAGAAGATGGCAGGG - Intergenic
968906941 4:3457936-3457958 GTTATCTGCGGAAGATGGCAGGG - Intergenic
969153541 4:5190739-5190761 GATGTCTGCAAGGGATGGCAAGG - Intronic
969975062 4:11090597-11090619 GGTATGTGCAAAAGAAGGAAAGG + Intergenic
970941613 4:21640943-21640965 GTTATCTGCAGAGAGTGGCAGGG - Intronic
971101015 4:23466453-23466475 GTTATCTGCAGAAGATAGCAGGG + Intergenic
971384203 4:26128030-26128052 GATCCCTGCAAGAGATGGCATGG + Intergenic
971817225 4:31505044-31505066 GTTATCTGCAGAAGATGGCAGGG - Intergenic
971979299 4:33732904-33732926 GTTACCTGCAGAAGATGGCAGGG + Intergenic
972095489 4:35342660-35342682 GTTACTTGCAGAAGACGGCAGGG - Intergenic
972201302 4:36717184-36717206 GTTATCTGTAGAAGATGGCAGGG + Intergenic
972805912 4:42529296-42529318 GTTACCTGCAGATTATGGCAGGG - Intronic
972882966 4:43448185-43448207 GTTATCTGCAGAAGATGGCAGGG + Intergenic
973102921 4:46294719-46294741 GTTATCTGCAGAAGATGGCAGGG - Intronic
973118435 4:46489012-46489034 GTTATCTGCAGAAGATGGCAGGG - Intergenic
973120984 4:46520929-46520951 GTTATTTGCAGAAGATGGCAGGG + Intergenic
973130194 4:46639726-46639748 GTTATATTCAGAACATGGCAGGG + Intergenic
974289564 4:59912711-59912733 GTTAACTGTAGAAGATGGCAGGG - Intergenic
974479041 4:62420867-62420889 ACTATCTGCAGAAGATGGCAAGG + Intergenic
974644620 4:64674795-64674817 ATTATCTGCAGGAAATGGCAGGG + Intergenic
974746918 4:66088936-66088958 GTTATCTTCAGAAGATGGCAGGG + Intergenic
975051320 4:69868170-69868192 GTTATCTGTAGATGATGGCAAGG - Intergenic
976034209 4:80795852-80795874 GTTATTTGCAGAAGATGGCAGGG + Intronic
977031618 4:91891376-91891398 GTTATCTACAGAAGATGGCAGGG - Intergenic
977204713 4:94155653-94155675 GTTATCTGCAGAAGATGACAGGG - Intergenic
977358494 4:95976296-95976318 GTTATCTGTAAAAGAAGCAAAGG - Intergenic
977430762 4:96928181-96928203 GGTATCTGCAGAAGATGGCAGGG - Intergenic
977465997 4:97383343-97383365 GTTATCTGCAGAAGATGGCAGGG - Intronic
977544750 4:98364335-98364357 TTTATCTGTAAAATTTGGCAGGG - Intronic
977626280 4:99192685-99192707 GTTATCTGCAGAAGATGGCAGGG + Intergenic
977701735 4:100029918-100029940 GTTATCTACAGAAGTTGGCAGGG + Intergenic
977930416 4:102743850-102743872 GTTATCTGCAGAAGATGGCAGGG + Intronic
978341594 4:107725580-107725602 GTTATCTGGAGAATATGTCAGGG + Intergenic
978772156 4:112467811-112467833 GTTATCTGCAGAAGATGGCAGGG + Intergenic
978862804 4:113470824-113470846 GTTATCTGCTAGAGATGCAATGG - Intronic
978899081 4:113926849-113926871 GTTATCTGCAGAAGACGGCAGGG + Intronic
978966847 4:114750913-114750935 ATTATCTGCAGAAGATGGCAGGG - Intergenic
979048206 4:115896511-115896533 GTTATCTGCAGAAGATGGCATGG - Intergenic
979767016 4:124474564-124474586 GTTATCTGTAGAAGATGGCAGGG - Intergenic
980385791 4:132087062-132087084 GTTATCTGCAGAAGATGGCAGGG + Intergenic
980387951 4:132111212-132111234 GTTATCTGCAGAATATGGCAGGG + Intergenic
980405895 4:132353822-132353844 GTTATCTGCAGAAGATGGCAGGG + Intergenic
980497529 4:133605393-133605415 GTTATCTACAGAAGATTACAGGG + Intergenic
980602156 4:135039489-135039511 GTGTTCTGCAGAAGATGGCAAGG - Intergenic
980629519 4:135414255-135414277 GTTATATGCAGAAGATGGCAGGG - Intergenic
980957728 4:139445886-139445908 GTTATCTGCAGAAGATGTCAGGG - Intergenic
981835000 4:149043914-149043936 GTTATCTGCAGAATATGGCCAGG - Intergenic
981873531 4:149515162-149515184 GTTATCTCCAAAAGATGGCAGGG - Intergenic
982354483 4:154451267-154451289 GTTGTCTGCAGAGAATGGCAGGG - Intronic
983027386 4:162755264-162755286 GTTATCTGCAGAAGATGGCAGGG - Intergenic
983147514 4:164235559-164235581 GTTATATGCAGAAACTGGCATGG + Intronic
983185060 4:164691544-164691566 GTTATCTGCAGAAGATGGCAGGG - Intergenic
983339032 4:166434438-166434460 GTTATCTGCAGAGAATGGAAGGG - Intergenic
984060288 4:174982055-174982077 GTTATCTGCAGAAGATGGCAGGG + Intergenic
986087106 5:4462687-4462709 TTTATCTGCAGAAGATAGCAGGG - Intergenic
986742915 5:10719475-10719497 GTTATCTGCAGAAGATGGCAGGG - Intronic
986938335 5:12918781-12918803 GTTACCTGAAGAAGATGGCAGGG + Intergenic
986959835 5:13199188-13199210 GTTAACTGCAGAAGATGGCAGGG - Intergenic
987153170 5:15061635-15061657 GTTATCTGCAGAAGATGGCAGGG - Intergenic
987176676 5:15318668-15318690 GTTATGTGCAGAAGAGCGCATGG - Intergenic
987504384 5:18749823-18749845 GTTAACTACAGAAGATGACAGGG - Intergenic
987578346 5:19758342-19758364 ATTATATGCAGAAGATGGCAGGG + Intronic
987628821 5:20440807-20440829 TTTGTCTGCAAGACATGGCAGGG - Intronic
987657142 5:20821682-20821704 GTTATTTGCAAAAGATGGCAGGG + Intergenic
987774797 5:22350636-22350658 TTTATCTGCAAAATATTGCATGG + Intronic
988056572 5:26105298-26105320 GTTATCTGCAGAAGATGGCAGGG + Intergenic
988169206 5:27632868-27632890 GCGATCTGCAGAAGATGGCAGGG + Intergenic
988188770 5:27901206-27901228 GTTATCTGCAGAAGATGGCAGGG - Intergenic
988228765 5:28448096-28448118 TTTATCTGCAGAAGATGGTAGGG - Intergenic
988292921 5:29314066-29314088 GTTATTTGCAAAATATCACAGGG + Intergenic
988562126 5:32290817-32290839 GTTATCTGCAGAAGATGGCAGGG - Intronic
988766409 5:34382266-34382288 GTTATCTGCAAAAGATGGCAGGG - Intergenic
989045211 5:37267621-37267643 GTTATCTGAAGAAGATGGTAGGG + Intergenic
989097827 5:37797290-37797312 GTTATCTGCAGAAGATGGCAGGG - Intergenic
989307507 5:39974651-39974673 GCTATCTGAAGAAGATGGCAGGG + Intergenic
989457648 5:41661798-41661820 GTTATCTGCAGAAGATGGCGGGG + Intergenic
989486388 5:41996389-41996411 GTTATCTGCAAAAGATGGCAGGG + Intergenic
991013810 5:61910930-61910952 GTTATCTGCAGAAGATAGCAGGG + Intergenic
991033541 5:62105892-62105914 GTTATCTGCAGAAAATGGCAGGG - Intergenic
991946142 5:71900110-71900132 GTTATCTGCAGAAGATGGCAGGG - Intergenic
992109884 5:73482907-73482929 GTTATCTGCAGAAGATGACAGGG + Intergenic
992242935 5:74789721-74789743 GTTATCTGAAGAAGATGGCAGGG - Intronic
992242951 5:74789837-74789859 GTTATCTGCAGAAGATGGCAGGG - Intronic
993203390 5:84847510-84847532 GTTATCTGCAGAAGACAGCAGGG - Intergenic
993319824 5:86458548-86458570 GTTATCTGCAGAAGATAGTAGGG - Intergenic
993367472 5:87050986-87051008 GTTATCTGCAGAAGATGGCAGGG + Intergenic
993791787 5:92218881-92218903 TTTATCTGCAGAAGATGGCAGGG - Intergenic
994291378 5:98032001-98032023 GTTATCCACAGAAGATGGCAGGG + Intergenic
994710814 5:103261204-103261226 GTTATCTTACAAAGTTGGCAAGG + Intronic
994855439 5:105113614-105113636 GTTATCTGCAGAAGATGGCAGGG + Intergenic
994984424 5:106915763-106915785 GTTATCTGCAGAAGATGGCAGGG + Intergenic
995269561 5:110205496-110205518 GCTATGTGCAGAAGATGGCAGGG + Intergenic
995427737 5:112043756-112043778 GTTATTTGCAGAAGATGGCAGGG + Intergenic
995776289 5:115727709-115727731 GTAATCTGCAGAAGATGGCACGG + Intergenic
996018555 5:118567826-118567848 GTTATCTGCAGAAGGTGGCAGGG - Intergenic
996164959 5:120212538-120212560 GTTATCTGCAGAAGATCTCAGGG + Intergenic
996392206 5:122973815-122973837 GTTATCTGCAGATGATGGCAGGG + Intronic
996488668 5:124066630-124066652 TTTATCTGCAAAAGGTAGCAGGG + Intergenic
996825559 5:127677805-127677827 ATTATCTGCAGAAGATGGCAGGG - Intergenic
997574033 5:134959182-134959204 TTTAGCTGCACAAGATGACAAGG - Intronic
998290340 5:140908581-140908603 GTTAGCTGCAGAAGATGGAAGGG + Intronic
998765468 5:145482091-145482113 GTTATGTGATAAAGATGACAGGG - Intronic
1000223250 5:159234278-159234300 GGTATCTGCAGAAGATGGCAGGG + Intergenic
1000263805 5:159615808-159615830 GATTTCTGCCATAGATGGCAAGG + Intergenic
1000416969 5:160993872-160993894 GTTATCTACAGAAGATGGCAGGG - Intergenic
1001173591 5:169444613-169444635 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1001326402 5:170730449-170730471 GTTATCTCCAAATGATTGCCAGG - Intronic
1002997962 6:2304717-2304739 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1003695902 6:8406169-8406191 GTCATCTGCAGAAGATGGCAGGG + Intergenic
1003791216 6:9549962-9549984 GTTATCTTCAGAAGATGGTAGGG - Intergenic
1003806324 6:9729288-9729310 GTCATCTCCAAAAGATGGCATGG + Intronic
1004824291 6:19403265-19403287 GTTATTTGCAGAAGATGGCAAGG + Intergenic
1005225802 6:23640409-23640431 ATTATCTACAGAAGATGGCATGG + Intergenic
1005398783 6:25410460-25410482 GTTACCTGCCCAAGATTGCATGG + Intronic
1006001552 6:30969046-30969068 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1006062348 6:31433193-31433215 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1008079361 6:47178415-47178437 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1008400288 6:51055442-51055464 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1008739732 6:54591502-54591524 GTCATCTGTAAAAGAGGTCATGG - Intergenic
1008820394 6:55625123-55625145 GTTATCTGCAGAAGACGGCTGGG - Intergenic
1008868031 6:56238656-56238678 GGTATCTGCTGAAGGTGGCAGGG - Intronic
1009308633 6:62122273-62122295 GTTATCTGCAGAAGATGGCAGGG - Intronic
1009390115 6:63135107-63135129 GTTATCTGCAGAAGATGACAGGG + Intergenic
1009660701 6:66606951-66606973 GTTATTTGCAGAAGAGGGCACGG + Intergenic
1009806491 6:68606923-68606945 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1009851929 6:69208987-69209009 GTTATCTGCAGAAGATGGCAGGG + Intronic
1010108013 6:72190935-72190957 GTTATCTGCAGAAGACAGCAGGG + Intronic
1010818628 6:80388371-80388393 GTTATCTGCAGATAATGGCAGGG - Intergenic
1011039348 6:83013303-83013325 GTTATCTGCAGAAGATGGCAGGG + Intronic
1011069097 6:83361636-83361658 TTTATCTGCAGAAGATGGCAGGG - Intronic
1011451172 6:87494018-87494040 GTTATGTGCAAGAGATTGCTGGG + Intronic
1011743576 6:90387568-90387590 GTCATCAGCAAAGGATGTCAAGG + Intergenic
1011756426 6:90502785-90502807 TTTAACTGCAATAGTTGGCATGG + Intergenic
1012108575 6:95197766-95197788 GTTATCTGCAGAAGGTGGGAGGG + Intergenic
1012344584 6:98170290-98170312 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1012730457 6:102874290-102874312 GTTATCTGTAGAAGATGGCAGGG - Intergenic
1012820799 6:104082889-104082911 GTTATCTGCAGAAGATGGCCGGG - Intergenic
1013406667 6:109849773-109849795 GTTATCTGTAGAAGATGGCAGGG - Intergenic
1013902280 6:115171519-115171541 ATTATCTGCCAGAGAAGGCATGG - Intergenic
1014105956 6:117561364-117561386 GTTCTCTGAAAAAAATGCCATGG + Exonic
1014363403 6:120508383-120508405 GTTATCTGAAAAAGATGGCAGGG + Intergenic
1014416982 6:121195360-121195382 GTTATCTGCAGAAGATGGTAGGG - Intronic
1014534201 6:122596659-122596681 GTTATCTGCAGAAGATGGCAGGG + Intronic
1014538834 6:122649791-122649813 GCTGTCTTCAGAAGATGGCAGGG + Intronic
1014631637 6:123796772-123796794 GTTGTCTGCAGAAGATGGCAGGG - Intergenic
1014943369 6:127469624-127469646 GTTATAGGGAAAAGATGGCAAGG + Intronic
1015095454 6:129409630-129409652 GTGATCTGCAGAAGATGGCAGGG + Intronic
1015443290 6:133272594-133272616 GTTATCTGTAGAAGATGGTTGGG + Intronic
1015466852 6:133557746-133557768 GTTATCAGCAGAAGACGGCAGGG + Intergenic
1015475745 6:133657462-133657484 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1016119918 6:140332721-140332743 GTTATCTGCAGAAAATGGCAAGG + Intergenic
1016147333 6:140692745-140692767 GTTATCTGCAGAAGATGGCATGG + Intergenic
1016186983 6:141209335-141209357 GTTATCTGTTGAAGATGGTATGG + Intergenic
1016576262 6:145572616-145572638 GTTATCTGCAGAAAACGGCAGGG + Intronic
1016788182 6:148036525-148036547 TTTATCTGCAACACAAGGCAGGG - Intergenic
1017604940 6:156123761-156123783 GTTATCCCCAAAATCTGGCATGG - Intergenic
1017977122 6:159368086-159368108 GTTATCTGCAGAAGATGGCTGGG + Intergenic
1018535036 6:164810523-164810545 GTTATATACAGAAGATGGCAGGG + Intergenic
1018599880 6:165527497-165527519 GTTATCTGGTGGAGATGGCAGGG - Intronic
1018803796 6:167243020-167243042 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1020396714 7:7725485-7725507 GTTATCTGCAAAAGATGGCATGG - Intronic
1020710345 7:11597596-11597618 GTTATCTGCAGAAGATGGCAGGG - Intronic
1021563869 7:21997675-21997697 GTTATCTACAAAGAATGGCAGGG + Intergenic
1021823710 7:24525210-24525232 GTTTTCTGGAAAAGTTGGTATGG - Intergenic
1022539574 7:31123439-31123461 ATTGTCTGCAGAAGAGGGCAGGG - Intergenic
1024040533 7:45550115-45550137 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1024486835 7:49928889-49928911 GTTATCTACAAAGAATAGCATGG + Intronic
1024632138 7:51258568-51258590 TTTATCTTCAAAAGCTGGAAAGG - Intronic
1024866098 7:53906314-53906336 GTTATCTGAAAAAGGTGGCAGGG - Intergenic
1024884346 7:54124684-54124706 GCTATCTAAAGAAGATGGCAGGG + Intergenic
1026046493 7:66909128-66909150 GTTATATGCAGAAGATGGCAGGG + Intergenic
1026286298 7:68966134-68966156 TTTATCTGAAAGAGATGCCAAGG - Intergenic
1026399990 7:70000242-70000264 ATAATCTGCAAAGGATGGAATGG + Intronic
1027685792 7:81277925-81277947 GTTATCTGCAGAAAATGGCAGGG - Intergenic
1028043856 7:86091436-86091458 GTTATCTGCAGAAAAGGGCTGGG - Intergenic
1028141731 7:87281954-87281976 GTTATCTTCAGAAGATGGCAGGG - Intergenic
1028935009 7:96455033-96455055 ATTATCTGCAGAAGATGGCAGGG - Intergenic
1030277454 7:107736084-107736106 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1030457466 7:109793082-109793104 GTTATCTGCAGAAGACGGCAAGG + Intergenic
1030461017 7:109836650-109836672 GCTATCAGCAAAATATCGCAAGG + Intergenic
1030479470 7:110084028-110084050 GTTTTCTGCAAAGGATGCCAGGG - Intergenic
1030869935 7:114743131-114743153 CTTATTTGCAAAATATGCCAAGG - Intergenic
1030931293 7:115525713-115525735 GTTATCTGCGGAAGATGGCAGGG + Intergenic
1031236823 7:119187985-119188007 GTTATCTGCAGAAGATGACAGGG - Intergenic
1031676554 7:124618319-124618341 GTTATCTGCAGAAAATGGCAGGG - Intergenic
1031761415 7:125717087-125717109 GTTATCTGAAAATAATGGTAGGG - Intergenic
1032153108 7:129446988-129447010 GTTATCTGCAGAAGATGGCAGGG + Intronic
1033630936 7:143157091-143157113 GTTCTCTGCTATAGAGGGCATGG + Intergenic
1034517455 7:151591845-151591867 ATTATCTGCAGGAGAAGGCATGG - Intronic
1034864491 7:154629370-154629392 GTTATCTGCATGAGATGTCAGGG - Intronic
1036527351 8:9547550-9547572 GTTATCCACAGAGGATGGCAGGG + Intergenic
1036790704 8:11717185-11717207 GTTACCTTCTAAAGAAGGCAGGG + Intronic
1037364597 8:18108299-18108321 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1038051675 8:23819935-23819957 GTTATTTGATAAAGAAGGCATGG + Intergenic
1039292314 8:36109913-36109935 GTTATCTACAGAGGATAGCAGGG + Intergenic
1039324175 8:36466556-36466578 GTTATCTACAGAAGATGTGAGGG + Intergenic
1040019245 8:42725415-42725437 TTTATCTTCAAAAAATGGAAAGG - Intronic
1040911942 8:52528387-52528409 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1041130753 8:54697225-54697247 GTTATCTTCAAAAACTGGAAAGG + Intergenic
1041186852 8:55309883-55309905 ATTAGCAGCAAATGATGGCAAGG - Intronic
1041934550 8:63321299-63321321 GTTATCTGCAGAAGATGACAGGG - Intergenic
1042001068 8:64124027-64124049 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1042085616 8:65105669-65105691 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1042342417 8:67694320-67694342 GTTATCTGCAGAAAATGGCAAGG - Intronic
1042928317 8:73989372-73989394 GTTAGCAGCCAAAAATGGCATGG - Intergenic
1043259974 8:78184224-78184246 GCTATCTGCAGAAGATGACAGGG + Intergenic
1044202387 8:89452457-89452479 GTTATCTGCAAAAGATGACATGG - Intergenic
1044285976 8:90412477-90412499 GTTATCTGCAGAAGATGGTAGGG + Intergenic
1044436335 8:92168178-92168200 GTTTCATGCAAAAGATGACAGGG - Intergenic
1044487153 8:92767151-92767173 GTTATATGCAGAAGATGTCATGG + Intergenic
1044774738 8:95676533-95676555 GTTATCTGCAGAGAATGGCATGG - Intergenic
1045221834 8:100207036-100207058 GTTATCTGCAGAAGATGGCAGGG - Intronic
1046063988 8:109175193-109175215 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1046197551 8:110884192-110884214 GTTATCTGCAGAAGAGGGCAGGG - Intergenic
1046417643 8:113937825-113937847 GTTGTCTGAAGAAGATGGCAGGG + Intergenic
1046585789 8:116147750-116147772 GTTATTTGCAGAAGATGGCAGGG + Intergenic
1049916625 9:324050-324072 TTTATCTGCAAAATAAGGTAAGG - Intronic
1050482670 9:6102572-6102594 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1052442273 9:28512313-28512335 GTTATCTGCAGAAGATGACAGGG + Intronic
1052713094 9:32081419-32081441 GATACTTGCTAAAGATGGCAAGG - Intergenic
1054931129 9:70636568-70636590 GTTATATCCCAAAGATTGCATGG - Intronic
1054978994 9:71182047-71182069 GTTATGTGCAAAAGAGAGTATGG - Intronic
1055678624 9:78691722-78691744 GTAATCTGCAGAGGATGACATGG + Intergenic
1055903945 9:81271235-81271257 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1056156661 9:83845178-83845200 GTTAGCTGCAGAAGATGGCGGGG - Intronic
1056314238 9:85372976-85372998 ATTATCTGCTGAAGATGGCAGGG + Intergenic
1056353877 9:85778349-85778371 GTTATCTGCAGAAGATGGCGGGG + Intergenic
1057864092 9:98665651-98665673 GTTCTCTGCTGCAGATGGCATGG - Intronic
1058019892 9:100076049-100076071 GTTATCTGCAGAAGATGGCAGGG - Intronic
1058259261 9:102809699-102809721 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1058544170 9:106042783-106042805 TATATCTGCAGAAGATGGCAGGG + Intergenic
1059196509 9:112375899-112375921 GTTATCTGCAGAAGAAGGCAGGG + Intergenic
1059928431 9:119236834-119236856 TTTTTCTGCTAAAGAGGGCAGGG + Intronic
1060178777 9:121517286-121517308 GTTATGTGCAGATGATGGCAAGG - Intergenic
1061076399 9:128344021-128344043 GTTGATTGCAAAAGAAGGCACGG + Intronic
1061660106 9:132124431-132124453 GTTAAGAGCAAAAGATGGCTAGG + Intergenic
1061849985 9:133408907-133408929 GTTACTTGCAAAAGGTGGCGGGG - Intronic
1062135466 9:134924992-134925014 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1186279491 X:7977087-7977109 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1186356261 X:8794419-8794441 CTTATCTGCAAAAGGAGACACGG - Intronic
1186384098 X:9091793-9091815 GTTATCTGCAGAAGATGGCAGGG + Intronic
1186469771 X:9812140-9812162 GTTGTCTGCAGAAGATGGCAGGG + Intronic
1186479763 X:9887725-9887747 GTTATCTGCACATGATAGAAGGG + Intronic
1186811157 X:13190146-13190168 TGTGTCTGCAGAAGATGGCATGG - Intergenic
1187140575 X:16589439-16589461 GTTGTATGGAAAGGATGGCAGGG - Exonic
1187604861 X:20871831-20871853 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1187881267 X:23849537-23849559 GTCAACTCCAAAAGATGGAAGGG + Intronic
1189154888 X:38746753-38746775 GTTATTTGCAGAAGATGGCAGGG + Intergenic
1190255268 X:48757772-48757794 GTTATCTGCAGAGAATAGCAGGG - Intergenic
1190527883 X:51346280-51346302 GTTATATGCAGAGCATGGCAGGG + Intergenic
1190996752 X:55617500-55617522 GTTATCTACAGAAGATGGCAGGG + Intergenic
1191095710 X:56671206-56671228 GTTATCTGTGGAAGATAGCAGGG + Intergenic
1191630041 X:63312620-63312642 GTTATCTGAAGAAGTTGACAGGG + Intergenic
1191658809 X:63629838-63629860 GTTATCTGCTGAAGATGGCAGGG + Intergenic
1191719245 X:64215741-64215763 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1191742545 X:64451340-64451362 GTTATCTGCAGAAGATGGCAAGG + Intergenic
1191759357 X:64629892-64629914 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1191769501 X:64740130-64740152 GTTATTTGCAGAAGAAGGCAGGG + Intergenic
1191790010 X:64960073-64960095 GTGATCTCCAAAAGATGGAAAGG + Intronic
1191932923 X:66394129-66394151 GTTATCTGCAGAAGACAGCAGGG - Intergenic
1191940886 X:66480797-66480819 GTTATCTGCAAACTATTGCAGGG - Intergenic
1191946351 X:66538979-66539001 ATTATCTGCAAAAGATGACTAGG - Intergenic
1192297715 X:69868048-69868070 GTTATCTGCAGAAGATGGCAGGG + Intronic
1192673257 X:73168449-73168471 GTTACCTGCAGAAGATGGCAGGG + Intergenic
1192898699 X:75471877-75471899 GTTATCTGCAGAAGATGGCAGGG - Intronic
1192996188 X:76515545-76515567 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1193053486 X:77125735-77125757 GTTTTCTGCAGAAGATGGCAGGG - Intergenic
1193297776 X:79852641-79852663 GTTATGTGCAGATGATGGCAGGG - Intergenic
1193356252 X:80523092-80523114 GTTATCTGCAGAAGACAGTAGGG - Intergenic
1193447151 X:81618738-81618760 GTTATCTGCAGGAGATGGCAGGG - Intergenic
1193464940 X:81836825-81836847 GTTATCTACAGAGGATGACAAGG + Intergenic
1193540006 X:82759600-82759622 TTTATTTGCAAAAGATCACATGG + Intergenic
1193904482 X:87225798-87225820 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1193914805 X:87351961-87351983 GTTATCTGCAGAAGATGGCAAGG + Intergenic
1193957279 X:87878177-87878199 GTTATCTGCAGAAGGTGGCAGGG - Intergenic
1194179595 X:90695968-90695990 GTTATCTGAAGAAGATGGCAGGG + Intergenic
1194210274 X:91062321-91062343 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1194443545 X:93961070-93961092 GTTATCTGCAGAAGATGGAAGGG - Intergenic
1194513421 X:94822285-94822307 GTTATCTGCAGAAGATGACAGGG + Intergenic
1194521078 X:94919406-94919428 GTTATCTGCAAAAGATGACAGGG - Intergenic
1194649418 X:96497839-96497861 GTTATCTGTAGATAATGGCAGGG - Intergenic
1194849250 X:98852207-98852229 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1195228464 X:102822238-102822260 GTTATCTAGGAAAGATGGCAGGG - Intergenic
1195782358 X:108479898-108479920 GTTTTTTGCAGAGGATGGCAGGG + Intronic
1196135973 X:112209876-112209898 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1197002283 X:121452888-121452910 GTTATCTGCAGAAGATGACAGGG - Intergenic
1197084201 X:122453532-122453554 GTTATCTGCAAAGGATGGCAAGG + Intergenic
1197097463 X:122612805-122612827 GTTATCTGCAGAAGATGGTAGGG - Intergenic
1197245050 X:124159027-124159049 GTTATCTGCAGAAGATGGCAGGG + Intronic
1197372061 X:125637899-125637921 GTTACCTGCAGAAGATGGCAGGG + Intergenic
1197380004 X:125727938-125727960 GTTTTCTGCAGAAGATGGCAGGG + Intergenic
1197386777 X:125812276-125812298 GATATCTGCAGTAGATTGCAGGG + Intergenic
1197477362 X:126941362-126941384 GTTATCTGCATAAGATGACAGGG + Intergenic
1197521992 X:127510338-127510360 GTTATCTGTAGATGGTGGCAGGG - Intergenic
1197591863 X:128419354-128419376 GTTATCTGCAGAAGATGACTGGG - Intergenic
1198169998 X:134096221-134096243 GTTATCTGTGGAGGATGGCAGGG - Intergenic
1198362621 X:135910693-135910715 GTTATCAATAAAAGAAGGCAAGG - Intronic
1198701295 X:139400263-139400285 GTTATCTGCAGAAAATGGAAGGG - Intergenic
1198934037 X:141887846-141887868 GTTATCTGCAGAAGATTGAAGGG - Intronic
1199144446 X:144348998-144349020 GGTATCTGAAGAAGATAGCAGGG + Intergenic
1199310430 X:146314433-146314455 GTTATCTGCAGAAGAAGGCAAGG + Intergenic
1199580346 X:149354142-149354164 GTTACCTGTGAATGATGGCAGGG - Intergenic
1200340498 X:155390673-155390695 GTTATCTGCAGAAGATGACAGGG + Intergenic
1200521267 Y:4211997-4212019 GTTATCTGCAGAAGATTTCAGGG - Intergenic
1200526257 Y:4278137-4278159 GTTATCTGAAGAAGATGGCAGGG + Intergenic
1200651666 Y:5847716-5847738 GTTATCTGCAGAAGATGGCAAGG - Intergenic
1200703740 Y:6423943-6423965 GGTGTCAGCAAAAGATGGCCTGG + Intergenic
1200709923 Y:6474114-6474136 GGTGTCTGCAAAAGATGGCTGGG + Intergenic
1200746062 Y:6904905-6904927 GTTACCCACAGAAGATGGCAGGG + Intergenic
1200914529 Y:8559836-8559858 GCTATCAGCAAAAGATGGTTGGG - Intergenic
1200917342 Y:8583015-8583037 GGTGTCAGCAAAAGATGGCCAGG - Intergenic
1200924494 Y:8642250-8642272 GATGTCAGCAAAAGATGGCTGGG - Intergenic
1200936091 Y:8739775-8739797 GGTGTCAGCAAAAGATGGCTGGG + Intergenic
1200939518 Y:8767229-8767251 GGTGTCAGCAAAAGATGGCCAGG + Intergenic
1200962878 Y:9011219-9011241 GGTGTCTGCAAAAGATGGCTGGG - Intergenic
1200973128 Y:9177743-9177765 TTTATCTACAGAAGATGGCAGGG + Intergenic
1200982309 Y:9273425-9273447 GGTGTCAGCAAAAGATGGCCAGG + Intergenic
1201024192 Y:9690594-9690616 GGTGTCTGCAAAAGATGGCTGGG - Intergenic
1201030371 Y:9740764-9740786 GGTGTCAGCAAAAGATGGCCTGG - Intergenic
1201193722 Y:11471450-11471472 GTTAACTGGAGAAGATGACAGGG + Intergenic
1201303817 Y:12533789-12533811 GTTATCTGCACATTATGGAAGGG + Intergenic
1201529655 Y:14977927-14977949 GTTATCTGCAGACTATGACAAGG + Intergenic
1201765800 Y:17572652-17572674 GTTATCTGCAGATAATGGCAGGG - Intergenic
1201796634 Y:17903444-17903466 GTTATCTGCAGAAAATGGCAGGG + Intergenic
1201804921 Y:18002541-18002563 GTTATCTGCAGAAAATGGCAGGG - Intergenic
1201835752 Y:18333337-18333359 GTTATCTGCAGATAATGGCAGGG + Intergenic
1202128091 Y:21586254-21586276 GCTGTCAGCAAAAGATGGCCAGG - Intergenic
1202137950 Y:21686770-21686792 TTTGTCTACAGAAGATGGCAGGG - Intergenic
1202150228 Y:21837562-21837584 GGTGTCTGCAAAAGATGGCTGGG + Intergenic
1202150882 Y:21842703-21842725 GGTGTCAGCAAAAGATGGCCAGG + Intergenic
1202176903 Y:22106398-22106420 GGTGTCAGCAAAAGATGGCTGGG + Intergenic
1202177214 Y:22108820-22108842 GTTGTCAGCAAAAGATGGCCGGG + Intergenic
1202182453 Y:22151146-22151168 GATGTCTGCAAAAGATGTCTGGG + Intergenic
1202208907 Y:22435256-22435278 GATGTCTGCAAAAGATGTCTGGG - Intergenic
1202214147 Y:22477564-22477586 GTTGTCAGCAAAAGATGGCCGGG - Intergenic
1202214458 Y:22479986-22480008 GGTGTCAGCAAAAGATGGCTGGG - Intergenic
1202358018 Y:24072506-24072528 GTTATCTGCAGAAAATGGCAGGG + Intergenic
1202359742 Y:24095356-24095378 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1202511036 Y:25574758-25574780 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1202512760 Y:25597607-25597629 GTTATCTGCAGAAAATGGCAGGG - Intergenic
1202590427 Y:26477125-26477147 GTTAACTGCAAAAGAAAGGAAGG + Intergenic