ID: 988766410

View in Genome Browser
Species Human (GRCh38)
Location 5:34382267-34382289
Sequence AGTTATCTGCAAAAGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988766410_988766412 -2 Left 988766410 5:34382267-34382289 CCTGCCATCTTTTGCAGATAACT No data
Right 988766412 5:34382288-34382310 CTACTCTCTTTTTGAGAGACAGG No data
988766410_988766416 22 Left 988766410 5:34382267-34382289 CCTGCCATCTTTTGCAGATAACT No data
Right 988766416 5:34382312-34382334 CTTGGCCTATTACTGGGCTTTGG 0: 17
1: 191
2: 171
3: 92
4: 154
988766410_988766413 4 Left 988766410 5:34382267-34382289 CCTGCCATCTTTTGCAGATAACT No data
Right 988766413 5:34382294-34382316 TCTTTTTGAGAGACAGGTCTTGG No data
988766410_988766417 25 Left 988766410 5:34382267-34382289 CCTGCCATCTTTTGCAGATAACT No data
Right 988766417 5:34382315-34382337 GGCCTATTACTGGGCTTTGGTGG 0: 13
1: 161
2: 162
3: 88
4: 160
988766410_988766415 16 Left 988766410 5:34382267-34382289 CCTGCCATCTTTTGCAGATAACT No data
Right 988766415 5:34382306-34382328 ACAGGTCTTGGCCTATTACTGGG No data
988766410_988766414 15 Left 988766410 5:34382267-34382289 CCTGCCATCTTTTGCAGATAACT No data
Right 988766414 5:34382305-34382327 GACAGGTCTTGGCCTATTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988766410 Original CRISPR AGTTATCTGCAAAAGATGGC AGG (reversed) Intergenic
No off target data available for this crispr