ID: 988766411

View in Genome Browser
Species Human (GRCh38)
Location 5:34382271-34382293
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 773
Summary {0: 5, 1: 185, 2: 202, 3: 119, 4: 262}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988766411_988766417 21 Left 988766411 5:34382271-34382293 CCATCTTTTGCAGATAACTACTC 0: 5
1: 185
2: 202
3: 119
4: 262
Right 988766417 5:34382315-34382337 GGCCTATTACTGGGCTTTGGTGG 0: 13
1: 161
2: 162
3: 88
4: 160
988766411_988766412 -6 Left 988766411 5:34382271-34382293 CCATCTTTTGCAGATAACTACTC 0: 5
1: 185
2: 202
3: 119
4: 262
Right 988766412 5:34382288-34382310 CTACTCTCTTTTTGAGAGACAGG No data
988766411_988766413 0 Left 988766411 5:34382271-34382293 CCATCTTTTGCAGATAACTACTC 0: 5
1: 185
2: 202
3: 119
4: 262
Right 988766413 5:34382294-34382316 TCTTTTTGAGAGACAGGTCTTGG No data
988766411_988766414 11 Left 988766411 5:34382271-34382293 CCATCTTTTGCAGATAACTACTC 0: 5
1: 185
2: 202
3: 119
4: 262
Right 988766414 5:34382305-34382327 GACAGGTCTTGGCCTATTACTGG No data
988766411_988766415 12 Left 988766411 5:34382271-34382293 CCATCTTTTGCAGATAACTACTC 0: 5
1: 185
2: 202
3: 119
4: 262
Right 988766415 5:34382306-34382328 ACAGGTCTTGGCCTATTACTGGG No data
988766411_988766416 18 Left 988766411 5:34382271-34382293 CCATCTTTTGCAGATAACTACTC 0: 5
1: 185
2: 202
3: 119
4: 262
Right 988766416 5:34382312-34382334 CTTGGCCTATTACTGGGCTTTGG 0: 17
1: 191
2: 171
3: 92
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988766411 Original CRISPR GAGTAGTTATCTGCAAAAGA TGG (reversed) Intergenic
901904051 1:12392682-12392704 CAGTAGTTATCTGCAGAAGATGG + Intronic
903104761 1:21067075-21067097 GATTACTTTTCTTCAAAAGAAGG - Intronic
903120068 1:21210392-21210414 GAGTAGTTATCCACAGAGGATGG - Intergenic
904179493 1:28655969-28655991 GAGTAGTTATCTGCAGAAGATGG + Intergenic
904335932 1:29797988-29798010 GAGTAGTTATCTGCAGAAGATGG - Intergenic
904419581 1:30383047-30383069 ACGCTGTTATCTGCAAAAGAGGG + Intergenic
905354067 1:37368789-37368811 GAGTAGTTATCTGCAGAAGATGG - Intergenic
905465225 1:38148101-38148123 GAGTAGTTATCTGAAGAAGATGG - Intergenic
905466467 1:38157927-38157949 GAGTAGTTCTCTACTAAAGAAGG - Intergenic
905725944 1:40252121-40252143 GAGTAGGTATCAGTAAAAGTTGG - Intergenic
906050488 1:42867416-42867438 GAGACATTATCTGCAGAAGATGG - Intergenic
906729010 1:48065216-48065238 AAATAGTTGTCTGCAAAAGGTGG + Intergenic
906879675 1:49576464-49576486 GAGTAGTTATGTGCAGAAAATGG - Intronic
907602083 1:55782145-55782167 GAGTAGTTATCTGTAGATGATGG + Intergenic
907766049 1:57411575-57411597 GAGAAGGGATCTGCAAAGGAGGG - Intronic
908361886 1:63376375-63376397 GATTAGTTATTTGAAAAATACGG - Intronic
909172608 1:72315462-72315484 GAGTAATTATCTGCAGAAGATGG + Intergenic
909576920 1:77185860-77185882 GAATAGTTATCTGCAGAAGATGG - Intronic
909810954 1:79931341-79931363 GAGTAGTTATCTGCAGAAGATGG - Intergenic
910370634 1:86512130-86512152 GAGTAGTTATCTGCAGAAGATGG - Intergenic
910538447 1:88327035-88327057 GAGTCCTTATTTGCAAAACAGGG - Intergenic
910561900 1:88599983-88600005 GAGTGGTTATCTGCAGAAGATGG - Intergenic
910565673 1:88640070-88640092 AAGTAGTTATCTGAGAATGATGG + Intergenic
910588216 1:88901728-88901750 GAGTAATTATCTGCAGAAGATGG - Intergenic
910630220 1:89346254-89346276 GAGTAGTTATCTGCAAAAGATGG - Intergenic
910638991 1:89439972-89439994 GAGTCATTATCTGCAGAAGATGG + Intergenic
910790321 1:91043722-91043744 GAGTAGTTATCTGCAGAAGATGG - Intergenic
910831098 1:91463422-91463444 GAATAGTTGTCTGCAAAAGATGG + Intergenic
910948214 1:92616690-92616712 GAGTAGTTATCTGAAGAAGATGG - Intronic
911109098 1:94164203-94164225 GAGCAGTTATCTTCAGAAGATGG + Intronic
911204510 1:95078924-95078946 GAATAAATATCTTCAAAAGATGG + Intergenic
911257326 1:95647362-95647384 GAGTAGTTATCTGCAGAAGATGG + Intergenic
911738398 1:101361917-101361939 GAGTAGTTATCTGCAGAAGATGG + Intergenic
911883570 1:103270451-103270473 GAGTAGTTATAGGCAGAAGATGG - Intergenic
911980426 1:104559423-104559445 GAGTAGTTATCTGCAGAAGATGG - Intergenic
911981899 1:104579260-104579282 GAGTAGTTATCTGCAAAGTATGG + Intergenic
912050677 1:105524945-105524967 AAGTAGTTATCTGCAGATGATGG + Intergenic
912067022 1:105756949-105756971 GAGTAGTTATATGCAGAAGAAGG - Intergenic
912129912 1:106588048-106588070 AAGCAGTTATCTGCAGAAGATGG + Intergenic
912212252 1:107568896-107568918 GAGTAGTTATCTGCAGAAGATGG - Intergenic
912252030 1:108021386-108021408 GAGTAGTTATCTGCAGAAGATGG + Intergenic
912733323 1:112128827-112128849 GAGTAGTCATCTGCAGAAGATGG + Intergenic
912894185 1:113568722-113568744 GAGTAGTCATTTGGAAAAAAAGG + Intronic
912943812 1:114068202-114068224 GAGTAGTTATCTGCAGAAGATGG + Intergenic
914690718 1:150024120-150024142 GAGCACTTATCTGCACAAGGTGG + Intergenic
915667671 1:157459641-157459663 GAGTAGTCATCTGCCAAAGATGG + Intergenic
916106330 1:161435325-161435347 GAGTAGTTATTTGCAGAAGATGG + Intergenic
917189756 1:172402471-172402493 GGGTAGTTATTTGCATAAAAAGG - Intronic
917217215 1:172690911-172690933 GAGTAGTTATCTGCAGAAGATGG + Intergenic
918755716 1:188337807-188337829 GAGTAGTTATCTGGAGAAGATGG + Intergenic
918815078 1:189171230-189171252 GAGTAGTTACCTGCAGAAGATGG - Intergenic
918918232 1:190671877-190671899 GAATAGTTATCTGCAGAAGATGG + Intergenic
918958243 1:191237951-191237973 GGGTAGTTGTCTTCAGAAGATGG - Intergenic
919124612 1:193379779-193379801 GAGTAGTTATCTACAGAAGATGG + Intergenic
919241772 1:194924206-194924228 GAGTAGTTATCTGCAGAAGATGG - Intergenic
919253576 1:195093219-195093241 CAATAGTCATTTGCAAAAGATGG - Intergenic
919317971 1:195999364-195999386 GAGTAGTTATCTGCAGAAGATGG - Intergenic
920197430 1:204238368-204238390 GAGTAGTTAGCTGCAGAAGATGG - Intronic
921447505 1:215263995-215264017 AAATACTTATCTGTAAAAGAAGG + Intergenic
921619819 1:217313139-217313161 GAGCAATTATCTGCAGACGATGG - Intergenic
923678133 1:236097871-236097893 GAGAAGTTACCTGCAGAAGAGGG + Intergenic
924840777 1:247707830-247707852 GAGTAGTTATCTGCAGAAGATGG + Intergenic
924847134 1:247785136-247785158 GAGTAGTTATCTGCAGAAGATGG + Intergenic
924937826 1:248787268-248787290 GACTTCTTATCTGAAAAAGAGGG - Intergenic
1062847686 10:720226-720248 GAGTAATTTTCTCCAAAATATGG - Intergenic
1064517643 10:16168254-16168276 GACTAGTTATCTGCAGAAGAGGG + Intergenic
1064545689 10:16448133-16448155 CACTAGTTATCTGCAGAAGATGG + Intronic
1065005325 10:21374166-21374188 AGGTAGTTATCTGCAGAAGATGG - Intergenic
1066167028 10:32799228-32799250 GAATGATTATCTGCAGAAGACGG + Intronic
1067125554 10:43512542-43512564 GAGTAGTTATCTGCAGAAGATGG + Intergenic
1067333139 10:45340219-45340241 CAGTAGTTATATGCAGAAAATGG - Intergenic
1067671394 10:48325414-48325436 GAGTAGTCATCTTCAAAAAGTGG + Intronic
1067754349 10:48993717-48993739 GAGTAGTTATCTCCAGAAGATGG + Intergenic
1068183667 10:53556531-53556553 GAGTACTTATATCCAAAAAATGG + Intergenic
1068447209 10:57138595-57138617 GAGTAGTTATCTGAAGAAGATGG - Intergenic
1068627594 10:59266006-59266028 GATTTGTGATCTGCCAAAGATGG + Intronic
1068837217 10:61568376-61568398 GAATAGTTATCTGCAGAAGATGG + Intergenic
1069123080 10:64593299-64593321 GAGTAGTTCTCTGAAAAGAATGG + Intergenic
1069192306 10:65506368-65506390 GAGTAGTTATCTGAAGAAAATGG + Intergenic
1069209893 10:65742852-65742874 GAGTAGTTATTTGCAGAGGATGG + Intergenic
1069790832 10:71019581-71019603 GAATAGTTATCTGCAGAAGATGG + Intergenic
1070206790 10:74272080-74272102 GTGTAGTTATTTGCATAAAAGGG + Intronic
1071267087 10:83974000-83974022 GAGTAGTTATCTGCAGAAGATGG + Intergenic
1071364469 10:84884519-84884541 GAGTAGTTATCTGCAGAAGATGG + Intergenic
1071673928 10:87637427-87637449 AAGTAGTTATCTTCAGAAGATGG + Intergenic
1071937688 10:90549278-90549300 GAGTAGTTATCTGCAGAAGATGG - Intergenic
1071942786 10:90607776-90607798 GAGTAGTTATCTGCAGAAGATGG + Intergenic
1072209259 10:93231676-93231698 GAGTAGTTATCTACAGAAGATGG + Intergenic
1072293679 10:93990038-93990060 GAGTTGTTGTCAGCAAAAGTTGG - Intergenic
1072360468 10:94654145-94654167 GAGTAATTGTCTACAGAAGATGG - Intergenic
1072689197 10:97560214-97560236 GAATGGTTATCTTCAAAAAAAGG - Intronic
1073088848 10:100915017-100915039 GAGTTGTCAGCTGCAAAAAAGGG - Intronic
1073557348 10:104465902-104465924 GAGTAGTTATCTGCAGAAGATGG - Intergenic
1073567900 10:104551201-104551223 GTGTAGTTCTCTGCAAAAAGAGG + Intergenic
1073830505 10:107378007-107378029 GAGCAGTTATCTGTAGATGATGG + Intergenic
1073918477 10:108432313-108432335 GAGTAGTTATCTGCAGAAGATGG + Intergenic
1073957685 10:108891651-108891673 GAGTAGTTATCTGCAGAAGATGG + Intergenic
1074632515 10:115274049-115274071 TAGTAGTTATCTGCAGAGGATGG + Intronic
1075579222 10:123604140-123604162 CATTGGTTATCTGCAAAAGAAGG - Intergenic
1075606788 10:123817401-123817423 GAGTCATTATTTGCAGAAGATGG - Intronic
1075875343 10:125801346-125801368 GAGGAGATATCTGGGAAAGAAGG + Intronic
1076089060 10:127663645-127663667 GACTTGATTTCTGCAAAAGAAGG - Intergenic
1076772630 10:132674837-132674859 GAGTAGTTACCTGCAGAAGATGG + Intronic
1076927416 10:133499224-133499246 GAGTAGTTATCTGCAGAAGATGG + Intergenic
1078056205 11:8010931-8010953 GAGTAGTTCTCTGCTGCAGAAGG + Intergenic
1080976679 11:37350574-37350596 GAGTAGTTATCTGCAGAAGATGG - Intergenic
1081065463 11:38534900-38534922 CAGTAGTTGTCTGCAGGAGATGG + Intergenic
1081072775 11:38631097-38631119 GAGTAGATGTCTGCAGAAGATGG - Intergenic
1081110476 11:39128395-39128417 GAGTAGTTATCTGCATAAGATGG - Intergenic
1081609060 11:44547854-44547876 GAGTAGTTATCTGTAGAAGATGG - Intergenic
1082671699 11:56043018-56043040 GAGTAGTTATCTGCAGAAGATGG - Intergenic
1083093144 11:60221103-60221125 AAGTAGTTATCTGCAGAAGATGG - Intronic
1085685961 11:78622166-78622188 GAATACTTATCTGCAGAAGATGG - Intergenic
1086047440 11:82549265-82549287 GAGAAGTTCTGAGCAAAAGAGGG - Intergenic
1086278611 11:85160428-85160450 GAGTACTTATCTGCAGAAGATGG - Intronic
1086834112 11:91600369-91600391 GAGTAGTTATCTGCAGAAGATGG - Intergenic
1087334543 11:96826638-96826660 GAGCAGTGATCTGCAAGACAAGG - Intergenic
1087374020 11:97320530-97320552 GAGTACTTATCTGCAGAAGATGG - Intergenic
1087398036 11:97627397-97627419 GAGTAGTTCTTGGGAAAAGATGG + Intergenic
1088047190 11:105468468-105468490 CAGTATTTATCTGGAAAAGAAGG - Intergenic
1088191661 11:107234514-107234536 GAGTAGTTATCTGCAGAATATGG + Intergenic
1088449353 11:109965344-109965366 GAGTAGTTATCTGTGGAAGATGG - Intergenic
1088836654 11:113583365-113583387 GAATAGTTATCTGCAGAAGATGG - Intergenic
1089459288 11:118643390-118643412 GCTTCCTTATCTGCAAAAGAAGG - Intronic
1090221616 11:125031609-125031631 GAGTAGTTATCTGCAGAAGATGG + Intronic
1091051737 11:132378732-132378754 GAGTAATTATTTGTAGAAGATGG - Intergenic
1091103471 11:132897241-132897263 GAGTAGTTATCTACAGATGATGG - Intronic
1091708703 12:2721427-2721449 GAATATTCATCTGCAGAAGAGGG - Intergenic
1092012417 12:5125625-5125647 GAGTGGCTATCTGCAAAAAAAGG + Intergenic
1092093282 12:5821627-5821649 GAGCAGTTATCTGCAGAAGATGG - Intronic
1092381559 12:8000915-8000937 GAGTAGTTATCTGCAGAAGATGG - Intergenic
1092585244 12:9893544-9893566 GAGTAGTTATTTGTAAGGGAGGG + Intronic
1093031872 12:14295973-14295995 GAGTAGTTATCTGCGGAAGATGG + Intergenic
1093036287 12:14335319-14335341 GATTAGTTATCTGCAGAAGATGG - Intergenic
1093048925 12:14484991-14485013 GAGTAGTTACCTGCAAAAGATGG + Intronic
1093341118 12:17975011-17975033 GAATAGTTATCTGCAACAGAGGG + Intergenic
1093392085 12:18635558-18635580 GACAGGTTATCTGCATAAGATGG + Intronic
1093645726 12:21583647-21583669 GAGTAGTTATCTGCAGAAGATGG - Intronic
1093964537 12:25310933-25310955 GGGTAGTTATCTGCAGAAGACGG - Intergenic
1094102527 12:26779239-26779261 GAGTAGTTATCTGCAGAAGATGG - Intronic
1094225315 12:28039062-28039084 GATTAGTTATATGAAATAGAAGG + Intergenic
1094310580 12:29076231-29076253 GAGTAGTTCTCTGCATGATAAGG + Intergenic
1094427385 12:30329000-30329022 GAATGATTATCTGCAGAAGAGGG + Intergenic
1095844401 12:46729991-46730013 GGGTAGTTATCTGCAGAAGATGG + Intergenic
1095856242 12:46863698-46863720 GAGTAGTTATCTGCAGAAGATGG + Intergenic
1096288711 12:50322937-50322959 AAGTAGTTATCTACAGAAGATGG - Intergenic
1096457471 12:51799460-51799482 GAGTAGTTATCTGCAGAAGATGG + Intronic
1097076999 12:56402418-56402440 AAGTAGTTATCGCCAGAAGATGG - Intergenic
1097437842 12:59572277-59572299 GGGTAGTTATCTGCAGAAGATGG + Intergenic
1097564649 12:61252452-61252474 GAGTAGTTATCTGCAGAAGATGG + Intergenic
1097821384 12:64132187-64132209 GAGCAGTTATCTGCAGAAGAAGG + Intronic
1098673039 12:73254221-73254243 GAGTAGTTAACTGCAGAAGATGG - Intergenic
1098716088 12:73829792-73829814 GAGTAGTTATCTGCAAAAGATGG - Intergenic
1098733289 12:74065608-74065630 CAGTAGTTATCTGCAGAAGATGG - Intergenic
1098807194 12:75034950-75034972 GAGTAGTTATCTGCAGAAGATGG - Intergenic
1098831237 12:75365474-75365496 TAAAAGTTATATGCAAAAGAAGG - Intronic
1099183381 12:79492611-79492633 GAGTAGTTATCTGCAGAAGATGG + Intergenic
1099365922 12:81765361-81765383 GAGTAGTTATCTGCAGAATATGG - Intergenic
1099367022 12:81779380-81779402 GAGTAATTATTTGCACATGAAGG - Intergenic
1099379384 12:81936563-81936585 GAGAAGTTATCTGCAGAAGATGG + Intergenic
1099397915 12:82164276-82164298 GAGTAGTATTCAGCAAAAGAAGG - Intergenic
1099526361 12:83723088-83723110 GAGTAGTTATCTGCAGAAGATGG - Intergenic
1099689779 12:85938014-85938036 GAGTAGTTATCTGCAGAAGATGG - Intergenic
1099821350 12:87715103-87715125 GAGTAGTCATCTGCAAAGAATGG + Intergenic
1099864696 12:88265052-88265074 GAATAGTTATCTGCAGAAGAAGG - Intergenic
1099995068 12:89769553-89769575 GAGTAGTTATCTGAAGAGGATGG + Intergenic
1100241154 12:92711631-92711653 GAGTAGTTATCTGCAGAAGATGG + Intergenic
1101222654 12:102657374-102657396 GAGTAGTTATCTGCAGAGGATGG - Intergenic
1101534669 12:105606127-105606149 GAGTAGTTATCTGCAGAAGATGG + Intergenic
1101543070 12:105682613-105682635 GAGTAGTTATCTGCAGAAGATGG - Intergenic
1102718568 12:114996449-114996471 GAGTAGTGCTCTGGAGAAGACGG - Intergenic
1103035610 12:117654040-117654062 GAGTAGTTATCTGCAGAAGATGG - Intronic
1104611323 12:130230499-130230521 AAGTACTTATTTTCAAAAGAAGG + Intergenic
1105066483 12:133204133-133204155 GAGTAGTGATTTCCAAATGAAGG - Intergenic
1105383972 13:19913201-19913223 GAGTAGTTATCTGCTGAGCATGG - Intergenic
1105740107 13:23315153-23315175 CAGTAGTTATCTTCAGAAGATGG - Intronic
1107557474 13:41529859-41529881 CAGGAGTTTTCTGAAAAAGATGG + Intergenic
1108302438 13:49092008-49092030 GAGTTGTTATCTGCGGAAGATGG + Intronic
1108904276 13:55449948-55449970 GATCAGTTATTTGCAGAAGATGG - Intergenic
1108914304 13:55588894-55588916 GAGTACTTATCTGCAGGAGATGG + Intergenic
1109293222 13:60500095-60500117 GAGCAGTTATCCACAGAAGATGG - Intronic
1109519019 13:63484778-63484800 GAATAGTTTTCTGCAGAAGGTGG - Intergenic
1109583046 13:64366144-64366166 GAGTAATTATCTGCAGAAGATGG - Intergenic
1109712682 13:66180845-66180867 CAGTAGTTTTCTACAGAAGATGG + Intergenic
1110834137 13:80064652-80064674 GAGCTGTTATCTGCAGAAGATGG + Intergenic
1111317500 13:86581780-86581802 GAGTAGTTATCTGCAGAAGATGG - Intergenic
1111555932 13:89881652-89881674 GAGTATCTATCTTCAAAAGATGG - Intergenic
1112097177 13:96146922-96146944 GAGAATTCAGCTGCAAAAGAAGG + Intronic
1112231128 13:97590187-97590209 GAGTAGTTATCTGCAGAAGATGG + Intergenic
1112249930 13:97770301-97770323 GAGTAATTATCTGCAGAAGATGG + Intergenic
1112990773 13:105511297-105511319 CAGTGGATAACTGCAAAAGAAGG - Intergenic
1113111597 13:106829592-106829614 AAGTAGTTATCTGCTGATGATGG + Intergenic
1113319707 13:109221686-109221708 GAGTCGTTATCTGCAGAAGATGG + Intergenic
1113824095 13:113236752-113236774 GACTGGTTCTCTGCAAAAGATGG - Intronic
1114205869 14:20570746-20570768 GAGTAGTTATCTGCAGAAGATGG - Intergenic
1114896348 14:26995323-26995345 AAGTAGTTATCTGCAGAGGATGG + Intergenic
1114905377 14:27120445-27120467 GAGTTGCTATCTGAAGAAGATGG + Intergenic
1115130691 14:30049237-30049259 GAGTAGTTATATGCAGAAGATGG - Intronic
1115310871 14:31976524-31976546 GAGTAGTTATCTACAGGAGATGG + Intergenic
1116058906 14:39896915-39896937 CAGTAGTTATCTGTAGAATATGG - Intergenic
1116068093 14:40009148-40009170 GAGTAGTTATCTGAAGAAGATGG - Intergenic
1116122798 14:40742213-40742235 GAATAAATATCTGCAAAAGAAGG - Intergenic
1116308047 14:43283470-43283492 GAATAGTTATCTGCAGAAGATGG + Intergenic
1116415070 14:44669289-44669311 GAGTAGTTATTTGCAGAAGATGG - Intergenic
1116531456 14:45978248-45978270 GAGTAGTTATCTGCAGAAGATGG + Intergenic
1116660934 14:47709462-47709484 AAATAGTTATCTGCCAAAGAGGG - Intergenic
1116941252 14:50793085-50793107 GAGTATATATCTGCACATGACGG + Intronic
1117108555 14:52424691-52424713 GAGTTGCCATCTGCAAAATAAGG - Intergenic
1117216841 14:53560152-53560174 GAGTAGTTATCTGCAGAAGATGG - Intergenic
1117596277 14:57329905-57329927 GAGTGGTTATCTGCAGAAGATGG + Intergenic
1117634131 14:57724350-57724372 GAGTAGTTATCTGCAGAAGATGG - Intronic
1118122435 14:62860193-62860215 GAGTAGTTATCTGCAGAAGACGG + Intronic
1118880776 14:69824041-69824063 AAGTAGTTATCTGCAGAAGATGG + Intergenic
1119059699 14:71462213-71462235 GAGTAGTTACCTGCAGAAGGCGG + Intronic
1120082026 14:80227553-80227575 GAGTAGTTATCTGCAGAAGATGG + Intronic
1120169405 14:81233963-81233985 GAATAGTTATCTGCAGAAAATGG - Intergenic
1120250742 14:82059672-82059694 TAGTAATTATCTGCAAATGATGG + Intergenic
1120555996 14:85930468-85930490 GGGTAGTTATCTGCATAAGATGG + Intergenic
1120710473 14:87788114-87788136 GAGTGGTTATCTACAAAGGATGG + Intergenic
1120973701 14:90230804-90230826 GAGTAGTCATCTGCAGAAGATGG - Intergenic
1126283608 15:46986254-46986276 GAGTAGTTGTCTGCAGAAGATGG - Intergenic
1126344162 15:47675454-47675476 AAGTAGTCATCTGCAAGACAAGG + Intronic
1126378033 15:48016018-48016040 CAGTAGTTAGGTTCAAAAGATGG + Intergenic
1126894544 15:53244035-53244057 GAGTTTTTAAATGCAAAAGATGG + Intergenic
1127356912 15:58209166-58209188 GAGTAGTTATCTGCAGAAGATGG - Intronic
1128903818 15:71450050-71450072 GAGTTGTGATGTGCAAACGAAGG + Intronic
1129040844 15:72685030-72685052 GAGTATTTATCTGAAAAAAGTGG + Intronic
1129797629 15:78390049-78390071 GTTTACTTATCTGTAAAAGAAGG + Intergenic
1131724008 15:95202772-95202794 GAGTAGTTATCTGCAGAAGATGG - Intergenic
1131877766 15:96828737-96828759 GAATAGATGTCTGCCAAAGAGGG + Intergenic
1132343208 15:101091037-101091059 GAGTCATTACCTGCTAAAGAGGG - Intergenic
1134342863 16:13360979-13361001 GAGAGGTTATCTCCAAAAGTTGG - Intergenic
1135937477 16:26793385-26793407 CAGTAATGATCTGAAAAAGATGG + Intergenic
1136250940 16:29004568-29004590 GAGTAGTTATCTGCAGAAGATGG - Intergenic
1137332450 16:47512362-47512384 AATTATTTATGTGCAAAAGAAGG + Intronic
1138868383 16:60850762-60850784 GAGTAGTTATCTGCAGAAGATGG - Intergenic
1140665882 16:77226998-77227020 TACTACTTGTCTGCAAAAGAAGG - Intergenic
1141559545 16:84858061-84858083 AAGTAGTTATCTGCAGAAGATGG + Intronic
1146237982 17:31185925-31185947 GAGTAGTTATCTGCAGAAGATGG - Intronic
1146836353 17:36113977-36113999 GAGTAGTTATCTGAACAAGATGG - Intergenic
1146850932 17:36221017-36221039 GAGTAGTTATCTGAACTAGATGG - Intronic
1148344006 17:46891319-46891341 GTTTCCTTATCTGCAAAAGAGGG - Intergenic
1151004778 17:70421761-70421783 GAGTACTTCTCTGCTGAAGATGG + Intergenic
1151037813 17:70821611-70821633 CAGTAGTTATCTGCAGAAGATGG + Intergenic
1151943487 17:77306862-77306884 GATTCCTTATCTGCAAAACAGGG + Intronic
1153089705 18:1330135-1330157 GAGTAGTTAACTGCAGAAGATGG - Intergenic
1153131277 18:1857736-1857758 GAATGGTTATCTGTAGAAGATGG + Intergenic
1153217695 18:2835629-2835651 GAGTAGTTATCTGCAGAAGATGG + Intergenic
1154068462 18:11131072-11131094 GAGTAGTTATCTGCAGAAGGTGG - Intronic
1154252673 18:12757302-12757324 GAGTAGTTACCTGCAGAAGATGG + Intergenic
1154366972 18:13720138-13720160 GAGCAGTTACCTGCAAAGGATGG + Intronic
1154506170 18:15042863-15042885 GAGTAGTTATCTGCAGAAGATGG - Intergenic
1155336985 18:24774781-24774803 GAGTAGTTATCCACAGAGGATGG + Intergenic
1155408168 18:25512974-25512996 GAGGACTTATCTGCAAGTGAGGG + Intergenic
1155786651 18:29911692-29911714 GAGATGTTAAATGCAAAAGATGG - Intergenic
1155940705 18:31799571-31799593 GAGTAGTTATCTGCAGAAGATGG - Intergenic
1156582550 18:38394437-38394459 GAGTAGTTATCTGCAGAAGATGG - Intergenic
1156606369 18:38671738-38671760 GAGTAGTTATCTTCAGAAGATGG - Intergenic
1156990306 18:43400802-43400824 GAGTAGTTATCTGCAGAAGACGG + Intergenic
1156998577 18:43497702-43497724 GAATAGTTATCTGAAGAAGATGG - Intergenic
1157341199 18:46780000-46780022 GAGTAGTTATCTGGAGAAGATGG - Intergenic
1157870934 18:51229608-51229630 GATTAGTTACCTGCAGAAGATGG + Intergenic
1157998506 18:52588151-52588173 GAGTAGTTATCTGCAGAAGATGG + Intronic
1158371428 18:56810109-56810131 TAGTCATTATCTGCAAAAGAAGG - Intronic
1158390908 18:57044215-57044237 CAGTAGTTATAAGCAAAAGGGGG + Intergenic
1159559107 18:69975378-69975400 GACTAGTTATCTGCAGAAGATGG + Intergenic
1160092461 18:75839988-75840010 GAGTAGTTATCTGCAGAATATGG - Intergenic
1160129488 18:76212014-76212036 CATTTGTTATCTGGAAAAGAAGG - Intergenic
1162285002 19:9731657-9731679 GGGTAGTTTCCTGCAGAAGATGG - Intergenic
1164097088 19:22021370-22021392 GAGTAGTTATCTGCAGAAAATGG + Intergenic
1164117260 19:22234601-22234623 GAGTAGTTATCTGCAGAAAATGG + Intergenic
1167951577 19:53031899-53031921 GAGTAGTTATCTGCAGAGGATGG - Intergenic
1168539338 19:57197397-57197419 GAGTAGTTATCTGCAGAAGATGG + Intronic
925460725 2:4060419-4060441 GAGTAGTTATCTGCAGAAGATGG - Intergenic
926266702 2:11329348-11329370 GAGTAGTTCTGTTTAAAAGAAGG + Intronic
926825568 2:16902257-16902279 GAACGGTTATCTGCAGAAGATGG + Intergenic
927008715 2:18879697-18879719 AAGTACTTATCTGCAGAAGATGG - Intergenic
927660429 2:24988642-24988664 GAGTATTTATCTGCAGAAGATGG - Intergenic
928137633 2:28700126-28700148 GAGTAGTTATCTTTTAATGAAGG + Intergenic
928188381 2:29136932-29136954 AAGTAGTTATTTTCAAAATATGG - Intronic
930295406 2:49547536-49547558 GAGTAGTTACCTGCAGAAGATGG + Intergenic
930377766 2:50589372-50589394 GAGTAGTTTCCTGCTAAGGAAGG + Intronic
931175535 2:59850795-59850817 GGGTAGTGATATGCAAAACACGG - Intergenic
932541254 2:72655476-72655498 AAGTTGTTACCTGTAAAAGAAGG + Intronic
932870709 2:75395108-75395130 GAGTAGTTATCTGCAGAAGATGG + Intergenic
933394465 2:81713382-81713404 GAGTAGTTATCTGCAGAAGATGG + Intergenic
934155226 2:89193011-89193033 GTGTAGGTATCTTTAAAAGAAGG - Intergenic
934212094 2:89989724-89989746 GTGTAGGTATCTTTAAAAGAAGG + Intergenic
935183933 2:100714874-100714896 GAGTAGTTATTTTCAGAAGATGG - Intergenic
935425112 2:102911352-102911374 GAGTAGTTATTTGCAGAAGATGG + Intergenic
935564311 2:104590278-104590300 GAGTAGTTATCTGCAGAAGATGG + Intergenic
936641223 2:114314665-114314687 GAGTAGTTATCTGGACAAGATGG - Intergenic
936677738 2:114734756-114734778 TAGTTGTTATTTGCAACAGATGG + Intronic
937343967 2:121111431-121111453 GAGTAGGTAAATGCCAAAGAAGG + Intergenic
937531190 2:122829581-122829603 GAGTATTTATCTGCAGAGGATGG - Intergenic
937785209 2:125887753-125887775 GAGTAGTTATCTGCAGAGGATGG + Intergenic
937800325 2:126074703-126074725 GAGTACTTATCTGAAGAAGATGG - Intergenic
937867148 2:126761057-126761079 GAGTAGTTATCTGCAGAGGACGG - Intergenic
939069059 2:137517831-137517853 GAGCAGTTATCTGCAGAAGATGG - Intronic
939213870 2:139212215-139212237 GAGTAGTTATCTGCAGAAGATGG - Intergenic
939633367 2:144551808-144551830 GAGTAGTTATCTGCAGATGATGG + Intergenic
939755230 2:146101779-146101801 GAGAAGTTATCTGCAGAGGAAGG - Intergenic
939806238 2:146778449-146778471 GAGTAGTTATCTGCAGAAGATGG - Intergenic
940248744 2:151649586-151649608 GAGTAATTATATGCAAAGAAGGG - Intronic
940472091 2:154113152-154113174 GAATAGTTATCTGCAGAAGATGG + Intronic
940605918 2:155924313-155924335 GAGCAGTTATCTGCAGAAGATGG + Intergenic
941330670 2:164174590-164174612 GAGCACTTATCTGACAAAGATGG + Intergenic
941668015 2:168261105-168261127 GAGTAGTTATCTGCAGAAGATGG - Intergenic
941965841 2:171300334-171300356 GAGTATTTATCTGTAAAATTAGG - Intergenic
942321944 2:174743521-174743543 GAGTACTTATCTGCAGATGATGG - Intergenic
943006894 2:182395816-182395838 GAGTAGTTATCTGGAGAAGATGG - Intronic
943191033 2:184680158-184680180 GGGTAGTTCTCTCCAAAGGAAGG - Intronic
943239221 2:185362597-185362619 GAGTAGTTATCTGCAGAAGATGG + Intergenic
943388127 2:187227111-187227133 GAGTAGTTATCTGCAGAAGATGG - Intergenic
943517600 2:188907267-188907289 AGCTAGTTATCTGCAGAAGATGG + Intergenic
943816232 2:192259427-192259449 AAGTAGTTATTTGGAAAAAAGGG - Intergenic
944222376 2:197315451-197315473 AAATTGTTATCTGCAGAAGAGGG - Intergenic
945544868 2:211138132-211138154 AAGTAGTTATCTGCAGAAGATGG - Intergenic
945642176 2:212443812-212443834 GAATACTTATCTGCAGAACATGG - Intronic
945717837 2:213380694-213380716 GAGTAGTTATCTGCAGAAGATGG + Intronic
945725847 2:213471520-213471542 GAGTAGTTATCTGCAGAAGATGG + Intronic
946076060 2:217074555-217074577 GAGCTGTCATCTGCAAAAGTAGG - Intergenic
946527870 2:220539992-220540014 AAATAGTTATCTGCAGAAGATGG + Intergenic
946703776 2:222437817-222437839 GAGTAGTTATCTGCAGAAAATGG + Intronic
946790919 2:223299735-223299757 GAGTAGTTATCTGCAAATGATGG - Intergenic
947440717 2:230118691-230118713 GAGTAGTTATCTGCAGAAGATGG + Intergenic
947440844 2:230120232-230120254 GAGTAGTTATCTGCAGAAGATGG - Intergenic
947994764 2:234517837-234517859 GTGTAGTAATCTAGAAAAGAGGG + Intergenic
1169680394 20:8205690-8205712 TTTTAGTTATTTGCAAAAGAGGG + Intronic
1171315863 20:24194190-24194212 AAGTAGTTATCCACAAAGGATGG - Intergenic
1171436117 20:25125923-25125945 GAGTAGTCATCTGAGGAAGATGG - Intergenic
1174665777 20:52256455-52256477 AAGTTCTGATCTGCAAAAGAAGG - Intergenic
1174801853 20:53570729-53570751 AAGTACTTATCTGCCAAGGAGGG - Intronic
1175411141 20:58770137-58770159 TAGTGGTTCTCTGCAAAGGAAGG + Intergenic
1176791683 21:13326161-13326183 GAGTAGTTATCTGCAGAAGATGG + Intergenic
1176998158 21:15580159-15580181 GAGTAGTTATCTGCAGAAGACGG - Intergenic
1177139420 21:17342294-17342316 GAGTGGTTATCTGCAGGAGACGG + Intergenic
1177192845 21:17870940-17870962 GAGTACTTATCTGCAGATGATGG + Intergenic
1177505563 21:22014207-22014229 GAGTAGTTATCTGCAGAAGATGG + Intergenic
1177913173 21:27056185-27056207 GAGTAGTTATCTGCAGAAGATGG - Intergenic
1177921295 21:27155703-27155725 GACTAGTTCTTTGCCAAAGATGG + Intergenic
1177933699 21:27316958-27316980 GAGTAGTTATCTGCAGAAGATGG + Intergenic
1177991073 21:28037163-28037185 GAGTAGTTATCTGCAGAAGATGG + Intergenic
1178012658 21:28305150-28305172 GAGTAGTTATCAGCAGAAGATGG - Intergenic
1178060757 21:28851163-28851185 GAGTAGTTATCTGCAGAAGATGG + Intergenic
1179415152 21:41192546-41192568 GAGTAGTTATCTGAAGAAGATGG + Intronic
1180591149 22:16938392-16938414 GAGCAGTTATCTGCAGAAGATGG + Intergenic
1181367438 22:22388969-22388991 GAGTAGCTACCTGCAGAAGATGG + Intergenic
1181420651 22:22795806-22795828 GAGTAGTTATCTGTAGAGGATGG - Intronic
1182375303 22:29842877-29842899 GAGGACTGATGTGCAAAAGAAGG - Intergenic
1184603563 22:45558400-45558422 GAGTAGTTATCTGCAGAAGATGG + Intronic
1185395609 22:50585894-50585916 GAGTAGTTCTCTGCTGCAGAAGG - Intronic
949125666 3:443171-443193 GAATAGTTATCTGCAGAAGATGG + Intergenic
949245865 3:1924897-1924919 GAGTAGTTATCTGCAGAAGGTGG - Intergenic
949304337 3:2622597-2622619 GAGGAGTTGTCTGCAAAATCTGG + Intronic
949417594 3:3830908-3830930 GAGTAGTTATCTGCAGAAGATGG + Intronic
949445609 3:4131028-4131050 GAGTAGTTATCTGCAGAAGATGG - Intronic
949638778 3:6012491-6012513 TAATAGTTATCTGCAAAAGATGG - Intergenic
949751316 3:7355537-7355559 GAGTAGTTATGTGCAAATGACGG - Intronic
949758686 3:7443796-7443818 GAGTAGTTATATTTAGAAGAGGG + Intronic
950756828 3:15180563-15180585 GAGTAATTATCATCACAAGACGG - Intergenic
950761132 3:15228242-15228264 GAATAGATATCAGCAATAGAAGG + Intronic
951003617 3:17592826-17592848 GAGTAGTTATCTACAGAAGATGG - Intronic
951122568 3:18945541-18945563 GAGTAGTTATCTGCAGAAGATGG - Intergenic
951384523 3:22027509-22027531 GAGTAGTTATCTGCAGAAGATGG - Intronic
951970765 3:28441891-28441913 GAGTAGTTATCTGCAGAAGATGG + Intronic
952363164 3:32651297-32651319 GAATAATTAACAGCAAAAGAGGG - Intergenic
952541033 3:34368179-34368201 GTTTACTTATCTGCAAAAGGAGG - Intergenic
952605447 3:35142041-35142063 GAGTATTTATCTGCAGAAGATGG + Intergenic
953728141 3:45418879-45418901 GTTTATTTATCTGTAAAAGAGGG + Intronic
953742673 3:45551062-45551084 GTTTCGTTATCTGCAAAAGGAGG - Intergenic
954048831 3:47955975-47955997 GAATAATTTTCTGCAAAAGAGGG - Intronic
954054116 3:48007651-48007673 GAGTAGTTATCTGTAGAAGATGG - Intronic
954511494 3:51129687-51129709 CAGTAGTTATCTGCAGAAGATGG + Intronic
954916715 3:54154586-54154608 GACAAGCTACCTGCAAAAGAAGG - Intronic
955035582 3:55264066-55264088 GAGTAGTTATCTGCAGAGGATGG - Intergenic
956306873 3:67835596-67835618 GAGTAGTTATCTGCAGAAGATGG - Intergenic
956360450 3:68441412-68441434 GAGTAGTAATCTGCAGAAGATGG - Intronic
956509659 3:69980346-69980368 GAGTAGTTATCTGCAGAAGATGG - Intergenic
957247583 3:77733923-77733945 GAGTAGTTATCTGCAGAAGATGG + Intergenic
957298502 3:78361669-78361691 AAGTAGTTATCAGTAGAAGATGG + Intergenic
957705355 3:83773507-83773529 GAATAGTGATCTTCAATAGAAGG - Intergenic
957754595 3:84469400-84469422 TAGTAGTTATCTGCAGAAGATGG - Intergenic
958487680 3:94732500-94732522 GAGTAGTTATCTGCAGAAGATGG + Intergenic
959203654 3:103279271-103279293 GAGTAGTTATCTGCAGAAGATGG + Intergenic
959226781 3:103597302-103597324 GAGTAGTTATCTGCAGAAGATGG + Intergenic
959230902 3:103649587-103649609 GAGCATTTATCTTCAAAGGAAGG - Intergenic
959377347 3:105602860-105602882 GAGTAGTTATCTGCGGAAGATGG + Intergenic
959439507 3:106359156-106359178 GAGTAGTTATCTGCAGAAGACGG - Intergenic
959674512 3:109019633-109019655 GAGAAATAATCTGCCAAAGATGG - Intronic
959746016 3:109777299-109777321 GAGTAGTTATCTGCAGAAGATGG + Intergenic
959997857 3:112698296-112698318 GAGTAGTTATCTGCAGAAGATGG - Intergenic
960349527 3:116575675-116575697 GAGTAGTTATCTTCAGAAAATGG - Intronic
960494748 3:118360806-118360828 GAGTAGTTATCTGAAGATGATGG + Intergenic
961262846 3:125616397-125616419 GAGTAGTTATCTGCAGAAGATGG - Intergenic
961710981 3:128828028-128828050 GACTAGTTATCTTCAGAAGATGG + Intergenic
962708110 3:138064160-138064182 GAGTAGGTAACAGCACAAGATGG - Intronic
963268118 3:143259272-143259294 GAATAGTTATCTGTAAAGGCTGG + Intergenic
963331819 3:143923399-143923421 GAGTAGTTATCTGCAGAAGATGG + Intergenic
963420519 3:145055650-145055672 GAGTAGTTTTCTGCAGAGAATGG - Intergenic
963661390 3:148132119-148132141 CAGTAGTTATCTGCAGAAGGTGG - Intergenic
964297671 3:155251895-155251917 GAGTAGTTATCTGCAGATGATGG - Intergenic
964679248 3:159318940-159318962 AGGTAGTTATCTGCAGAAGATGG + Intronic
965226769 3:166000790-166000812 GAGTAGTTATCTGCAGAAGATGG + Intergenic
965291743 3:166889606-166889628 GAGTAGTTATATGCAGAAGATGG + Intergenic
965708647 3:171534805-171534827 GAGTAGTTATCTGCAGAGGATGG + Intergenic
965893160 3:173540120-173540142 GGGTAGTCATCTGCAGAGGATGG + Intronic
966044332 3:175530947-175530969 GAGTAGTTATCTGCAGAAGATGG + Intronic
966445691 3:179998533-179998555 GAGTAGTTATCTGCAGAAGATGG - Intronic
966480565 3:180403940-180403962 GAGGAGTTATCTGCAGAGGGTGG - Intergenic
966661311 3:182417983-182418005 GAATAGTTATCTGCAAATGATGG - Intergenic
967039240 3:185674288-185674310 GAGTTGATAACTGCAAAAGGTGG + Intronic
967831771 3:193925964-193925986 GAGTAGTTTTCTGTAGAGGATGG - Intergenic
968800181 4:2738095-2738117 GAGTAGTTAGCTGCAGAAGATGG - Intergenic
968906943 4:3457941-3457963 GAGTAGTTATCTGCGGAAGATGG - Intergenic
970816400 4:20161278-20161300 GAGTGGTTATCTACAGAAGATGG - Intergenic
971817227 4:31505049-31505071 GAGTAGTTATCTGCAGAAGATGG - Intergenic
971979297 4:33732899-33732921 GAGCAGTTACCTGCAGAAGATGG + Intergenic
972085221 4:35207088-35207110 GAGTAGTTATCTGCAGAAGTCGG - Intergenic
972201300 4:36717179-36717201 GAGTAGTTATCTGTAGAAGATGG + Intergenic
972805914 4:42529301-42529323 GAGTAGTTACCTGCAGATTATGG - Intronic
972882964 4:43448180-43448202 GAGTAGTTATCTGCAGAAGATGG + Intergenic
972883291 4:43450613-43450635 GCTTGGTTAGCTGCAAAAGATGG - Intergenic
973102923 4:46294724-46294746 GAGTAGTTATCTGCAGAAGATGG - Intronic
973118437 4:46489017-46489039 GGGCAGTTATCTGCAGAAGATGG - Intergenic
973120982 4:46520924-46520946 GAGTTGTTATTTGCAGAAGATGG + Intergenic
973130192 4:46639721-46639743 GAGTAGTTATATTCAGAACATGG + Intergenic
973152361 4:46904005-46904027 GAATAATCATCTGCAAAAAAAGG + Intronic
973900222 4:55461811-55461833 GTTTTGTTATCTGCAAAAAAAGG - Intronic
974262373 4:59542295-59542317 GAATAGTTATCTGCAGAAGATGG + Intergenic
974289566 4:59912716-59912738 GGGTAGTTAACTGTAGAAGATGG - Intergenic
974479040 4:62420862-62420884 GAATAACTATCTGCAGAAGATGG + Intergenic
974564787 4:63568287-63568309 GAGTAGTTATCTCCAGAAGATGG - Intergenic
974644618 4:64674790-64674812 GAGTAATTATCTGCAGGAAATGG + Intergenic
974727210 4:65812498-65812520 TAGTAGTTATCTGCAGAAGATGG - Intergenic
974746916 4:66088931-66088953 AAGTAGTTATCTTCAGAAGATGG + Intergenic
975024466 4:69531606-69531628 GAGTAGTTATCTGCAGAAGATGG - Intergenic
975051321 4:69868175-69868197 GAGTAGTTATCTGTAGATGATGG - Intergenic
975386718 4:73767535-73767557 GAGTAGTTATCTACAGAAGATGG + Intergenic
976034207 4:80795847-80795869 GAGTAGTTATTTGCAGAAGATGG + Intronic
976886446 4:89990440-89990462 GAGTAGTTACCTATAAATGACGG + Intergenic
977031620 4:91891381-91891403 GAATAGTTATCTACAGAAGATGG - Intergenic
977430764 4:96928186-96928208 GAGTAGGTATCTGCAGAAGATGG - Intergenic
977465999 4:97383348-97383370 CAGTAGTTATCTGCAGAAGATGG - Intronic
977626278 4:99192680-99192702 GAGTAGTTATCTGCAGAAGATGG + Intergenic
977701733 4:100029913-100029935 GAGTAGTTATCTACAGAAGTTGG + Intergenic
977779265 4:100961233-100961255 TAGTAGCTATCTACAAATGAGGG - Intergenic
977833277 4:101618194-101618216 GAGTAGTTATCTGCAGAAGTTGG + Intronic
977930414 4:102743845-102743867 GAGTAGTTATCTGCAGAAGATGG + Intronic
978322928 4:107517875-107517897 AAGTAGGTATCTGTAAAAGGAGG - Intergenic
978772154 4:112467806-112467828 GAGTAGTTATCTGCAGAAGATGG + Intergenic
978899079 4:113926844-113926866 GAGTTGTTATCTGCAGAAGACGG + Intronic
978966849 4:114750918-114750940 GAACAATTATCTGCAGAAGATGG - Intergenic
979048207 4:115896516-115896538 AAGTAGTTATCTGCAGAAGATGG - Intergenic
979268415 4:118731323-118731345 GTGTTGATATGTGCAAAAGATGG + Exonic
979597353 4:122548832-122548854 GAGTATGTAGCTGCAAAACAAGG + Intergenic
979767018 4:124474569-124474591 GACTAGTTATCTGTAGAAGATGG - Intergenic
980385789 4:132087057-132087079 GAGTAGTTATCTGCAGAAGATGG + Intergenic
980387949 4:132111207-132111229 GAGTAGTTATCTGCAGAATATGG + Intergenic
980405893 4:132353817-132353839 AAGTAGTTATCTGCAGAAGATGG + Intergenic
980629521 4:135414260-135414282 GAATAGTTATATGCAGAAGATGG - Intergenic
980945657 4:139317880-139317902 GAGTAGAAATCTGCAAAACAAGG - Intronic
981462809 4:145031779-145031801 GAGTAGTTATTTGCAAAAGATGG - Intronic
981641686 4:146951208-146951230 GTGTAGATATATGCAAAAAATGG + Intergenic
981668137 4:147254716-147254738 GATTAGTTTTCTGGAAAAAAAGG - Intergenic
981832947 4:149022990-149023012 GAATTGATATCTGCAGAAGATGG - Intergenic
981835001 4:149043919-149043941 GAGTAGTTATCTGCAGAATATGG - Intergenic
981873533 4:149515167-149515189 GAGTAGTTATCTCCAAAAGATGG - Intergenic
982354485 4:154451272-154451294 GAGTAGTTGTCTGCAGAGAATGG - Intronic
982597777 4:157407052-157407074 GAGTAGTTATCTGCAGAAGATGG + Intergenic
982623344 4:157732927-157732949 GAGTGGTTATCTGCAGAAGATGG + Intergenic
982847767 4:160274270-160274292 AAGTAGTTATCTGCAGAAGATGG - Intergenic
983027388 4:162755269-162755291 GAGTAGTTATCTGCAGAAGATGG - Intergenic
983185062 4:164691549-164691571 GAGTAGTTATCTGCAGAAGATGG - Intergenic
983339034 4:166434443-166434465 GAGAAGTTATCTGCAGAGAATGG - Intergenic
983582674 4:169324786-169324808 GAGTAGTTATCTGCAGAAGATGG - Intergenic
984060286 4:174982050-174982072 GAGTAGTTATCTGCAGAAGATGG + Intergenic
984876940 4:184377394-184377416 AAGTAGTTATCTTCAAACAATGG - Intergenic
985312839 4:188620417-188620439 GTTTAGTTAACTGCAAATGAAGG - Intergenic
985431531 4:189885998-189886020 GAGTACTTAAAAGCAAAAGAGGG + Intergenic
986037035 5:3950463-3950485 GAGTAGCTATCTGCAGAAAATGG + Intergenic
986742917 5:10719480-10719502 GAGTAGTTATCTGCAGAAGATGG - Intronic
986938333 5:12918776-12918798 GAGTAGTTACCTGAAGAAGATGG + Intergenic
986959837 5:13199193-13199215 GAGTAGTTAACTGCAGAAGATGG - Intergenic
987153172 5:15061640-15061662 GAGTAGTTATCTGCAGAAGATGG - Intergenic
987468191 5:18297010-18297032 GAGTAGTTATCTGCAGAAGATGG + Intergenic
987578344 5:19758337-19758359 CAGTAATTATATGCAGAAGATGG + Intronic
987657140 5:20821677-20821699 GAGTAGTTATTTGCAAAAGATGG + Intergenic
987885439 5:23806474-23806496 GGGTAGTTATCTGCAGAAGATGG - Intergenic
988056570 5:26105293-26105315 GAGTAGTTATCTGCAGAAGATGG + Intergenic
988079833 5:26401445-26401467 GAGTAGTTATCTGCAGATGATGG + Intergenic
988107756 5:26772521-26772543 GAGTAGTTATCTGCAGAAGATGG - Intergenic
988169204 5:27632863-27632885 GAGTAGCGATCTGCAGAAGATGG + Intergenic
988188772 5:27901211-27901233 GAGTGGTTATCTGCAGAAGATGG - Intergenic
988228767 5:28448101-28448123 AAGTATTTATCTGCAGAAGATGG - Intergenic
988562128 5:32290822-32290844 GAGTCGTTATCTGCAGAAGATGG - Intronic
988766411 5:34382271-34382293 GAGTAGTTATCTGCAAAAGATGG - Intergenic
989045209 5:37267616-37267638 GAGTGGTTATCTGAAGAAGATGG + Intergenic
989097829 5:37797295-37797317 GAGTAGTTATCTGCAGAAGATGG - Intergenic
989307505 5:39974646-39974668 GACTAGCTATCTGAAGAAGATGG + Intergenic
989340110 5:40364557-40364579 GAGTAGTTATCTGCAGGGGATGG - Intergenic
989457645 5:41661793-41661815 GAGTAGTTATCTGCAGAAGATGG + Intergenic
989486386 5:41996384-41996406 GAGTAGTTATCTGCAAAAGATGG + Intergenic
991033543 5:62105897-62105919 GAGTAGTTATCTGCAGAAAATGG - Intergenic
991234164 5:64375138-64375160 GAGTAGTTATCCACAGAGGATGG - Intergenic
991946144 5:71900115-71900137 CAGTAGTTATCTGCAGAAGATGG - Intergenic
992242937 5:74789726-74789748 GAGTAGTTATCTGAAGAAGATGG - Intronic
992242953 5:74789842-74789864 GAGCAGTTATCTGCAGAAGATGG - Intronic
992657448 5:78924249-78924271 GTTTTGTTATCTGCAAAATAGGG - Intronic
992849701 5:80794535-80794557 GAGTAGTTATGTGAGAGAGAAGG + Intronic
993231903 5:85247558-85247580 GAATAGTTTTCTGCAAAAGATGG + Intergenic
993367470 5:87050981-87051003 GAGTAGTTATCTGCAGAAGATGG + Intergenic
993412584 5:87591837-87591859 GAGTAGTTATCTGCAGAAGATGG + Intergenic
993620572 5:90163018-90163040 GAGTAGTTTTGTGGAAGAGATGG - Intergenic
993780692 5:92062369-92062391 GAGTAGTTATCTGCAGAAGATGG - Intergenic
993791789 5:92218886-92218908 GAATATTTATCTGCAGAAGATGG - Intergenic
994291376 5:98031996-98032018 AAGTAGTTATCCACAGAAGATGG + Intergenic
994510223 5:100693651-100693673 AAGAAGCTATCTGCAAAAGCTGG - Intergenic
994855437 5:105113609-105113631 GAGTAGTTATCTGCAGAAGATGG + Intergenic
994984422 5:106915758-106915780 AGTTAGTTATCTGCAGAAGATGG + Intergenic
995269559 5:110205491-110205513 GAGTAGCTATGTGCAGAAGATGG + Intergenic
995427735 5:112043751-112043773 GAGTAGTTATTTGCAGAAGATGG + Intergenic
995776288 5:115727704-115727726 GAGTAGTAATCTGCAGAAGATGG + Intergenic
996018557 5:118567831-118567853 GAGTAGTTATCTGCAGAAGGTGG - Intergenic
996392204 5:122973810-122973832 GAGTAGTTATCTGCAGATGATGG + Intronic
996825561 5:127677810-127677832 GAGTAATTATCTGCAGAAGATGG - Intergenic
997702829 5:135916359-135916381 GAGAAGTTATATGCTGAAGATGG + Intergenic
997754614 5:136384635-136384657 GTGCAGTTACTTGCAAAAGAGGG + Intronic
998290338 5:140908576-140908598 GAGTAGTTAGCTGCAGAAGATGG + Intronic
999423062 5:151461505-151461527 GAGTAGTCATTTGCAAAATGTGG + Intronic
1000109162 5:158090775-158090797 GATTACTTATCTGCAAATGAAGG - Intergenic
1000223248 5:159234273-159234295 GAGTAGGTATCTGCAGAAGATGG + Intergenic
1000354584 5:160381732-160381754 AAATAGTTATCTACAGAAGAGGG - Intergenic
1000416971 5:160993877-160993899 GAGTAGTTATCTACAGAAGATGG - Intergenic
1000577063 5:162987792-162987814 GAATAAATATCTGAAAAAGAGGG + Intergenic
1001173593 5:169444618-169444640 GAGTAGTTATCTGCAGAAGATGG - Intergenic
1001315339 5:170637684-170637706 GAGTTGTTATCTGGAAGAGGCGG - Intronic
1002187577 5:177461621-177461643 AAGAAGTTATCTGCAAAACAAGG - Intronic
1002997964 6:2304722-2304744 GAGTAGTTATCTGCAGAAGATGG - Intergenic
1003695900 6:8406164-8406186 GAGTAGTCATCTGCAGAAGATGG + Intergenic
1003758605 6:9150057-9150079 AAGTAGTTATCTGCAGAATATGG - Intergenic
1003791218 6:9549967-9549989 GAGTAGTTATCTTCAGAAGATGG - Intergenic
1003826449 6:9957987-9958009 GAGAAGTTTTCTGGGAAAGAGGG - Intronic
1004561368 6:16754690-16754712 GAGGACTGATATGCAAAAGAAGG + Intronic
1004824290 6:19403260-19403282 GAGTAGTTATTTGCAGAAGATGG + Intergenic
1005185166 6:23157048-23157070 GAGTAGTTATCTGCAGAAGATGG - Intergenic
1005197848 6:23309934-23309956 AAGTATTTATCTGCAAAACCAGG + Intergenic
1006001554 6:30969051-30969073 GAGTAGTTATCTGCAGAAGATGG - Intergenic
1006062350 6:31433198-31433220 GAGTAGTTATCTGCAGAAGATGG - Intergenic
1006540596 6:34736865-34736887 GGGTAGTTATATGTAAAATAGGG - Intergenic
1007431047 6:41777355-41777377 GAGAAGTGATCTGCAGCAGATGG + Intronic
1008079359 6:47178410-47178432 GAGTAGTTATCTGCAGAAGATGG + Intergenic
1008266924 6:49439313-49439335 GAGTAGTTATCTGCAGAAGATGG + Intronic
1008400290 6:51055447-51055469 GAGTAGTTATCTGCAGAAGATGG - Intergenic
1008820396 6:55625128-55625150 GAGTAGTTATCTGCAGAAGACGG - Intergenic
1009200105 6:60734423-60734445 CAATAATTATCTGGAAAAGAAGG + Intergenic
1009308635 6:62122278-62122300 GGATGGTTATCTGCAGAAGATGG - Intronic
1009660700 6:66606946-66606968 GGGTAGTTATTTGCAGAAGAGGG + Intergenic
1009770336 6:68136876-68136898 GACTAGTTATCTGCAGAAGATGG + Intergenic
1009806493 6:68606928-68606950 GAGTAGTTATCTGCAGAAGATGG - Intergenic
1009851927 6:69208982-69209004 GATTAGTTATCTGCAGAAGATGG + Intronic
1010323575 6:74540465-74540487 GAGTAGTTATCTGCAGAAGATGG - Intergenic
1010325333 6:74556623-74556645 GAGTAGTTATCTTCAGAGGATGG + Intergenic
1010406988 6:75516860-75516882 GAGCAGTTACCTGCAGATGATGG + Intergenic
1010818630 6:80388376-80388398 GAGTAGTTATCTGCAGATAATGG - Intergenic
1010938247 6:81886441-81886463 GAGTAGTTATCTGTAGAAGATGG + Intergenic
1011039346 6:83013298-83013320 GAACAGTTATCTGCAGAAGATGG + Intronic
1011069099 6:83361641-83361663 GCTTATTTATCTGCAGAAGATGG - Intronic
1012010789 6:93781972-93781994 GAAGAGTTGCCTGCAAAAGAAGG - Intergenic
1012108572 6:95197761-95197783 GAGTAGTTATCTGCAGAAGGTGG + Intergenic
1012226095 6:96704800-96704822 GAGTAGTTATCTGCAGAAGATGG - Intergenic
1012344586 6:98170295-98170317 GAGTAGTTATCTGCAGAAGATGG - Intergenic
1012730459 6:102874295-102874317 GAGTAGTTATCTGTAGAAGATGG - Intergenic
1012820801 6:104082894-104082916 GAGTAGTTATCTGCAGAAGATGG - Intergenic
1012920796 6:105219569-105219591 GATTAGTTATCTGCAGAAGATGG + Intergenic
1013406669 6:109849778-109849800 GAGTAGTTATCTGTAGAAGATGG - Intergenic
1013777255 6:113692207-113692229 GTCTCCTTATCTGCAAAAGAGGG - Intergenic
1013902281 6:115171524-115171546 GAGCAATTATCTGCCAGAGAAGG - Intergenic
1014363401 6:120508378-120508400 GGGTAGTTATCTGAAAAAGATGG + Intergenic
1014394530 6:120909070-120909092 GAGTAGCTACCTTTAAAAGAGGG + Intergenic
1014416984 6:121195365-121195387 GAGTGGTTATCTGCAGAAGATGG - Intronic
1014534199 6:122596654-122596676 ATCTAGTTATCTGCAGAAGATGG + Intronic
1014538832 6:122649786-122649808 GAGTAGCTGTCTTCAGAAGATGG + Intronic
1014631639 6:123796777-123796799 GAGTAGTTGTCTGCAGAAGATGG - Intergenic
1015095452 6:129409625-129409647 GAGTAGTGATCTGCAGAAGATGG + Intronic
1015443288 6:133272589-133272611 AGGTAGTTATCTGTAGAAGATGG + Intronic
1015466850 6:133557741-133557763 AAGTAGTTATCAGCAGAAGACGG + Intergenic
1015475747 6:133657467-133657489 GTGTAGTTATCTGCAGAAGATGG - Intergenic
1015806913 6:137118983-137119005 GACTAGTTATTTGCTGAAGAGGG + Intergenic
1015862090 6:137691817-137691839 GAGTAGTTATCTGTGGATGATGG - Intergenic
1016119917 6:140332716-140332738 GAGTAGTTATCTGCAGAAAATGG + Intergenic
1016132842 6:140498032-140498054 GAATAGTTATCTGCAGAGGATGG + Intergenic
1016144288 6:140649378-140649400 GAGTAGTTATCTGCAGAAGATGG - Intergenic
1016147332 6:140692740-140692762 GAGTAGTTATCTGCAGAAGATGG + Intergenic
1016174917 6:141069119-141069141 GAGTAGTTATTTGCAGAAGATGG + Intergenic
1016419616 6:143870706-143870728 GAGTAATTATCTGTAGAAGATGG + Intronic
1016576260 6:145572611-145572633 GAGTAGTTATCTGCAGAAAACGG + Intronic
1017016030 6:150100188-150100210 GACTACTTATCAGCAGAAGAAGG + Intergenic
1017388458 6:153912231-153912253 GAGTAGTTGCCTGCAGAAGATGG + Intergenic
1017700500 6:157064845-157064867 GAGTAGTAATCAAAAAAAGAGGG - Intronic
1017977120 6:159368081-159368103 GAGTAGTTATCTGCAGAAGATGG + Intergenic
1018599882 6:165527502-165527524 GAGTAGTTATCTGGTGGAGATGG - Intronic
1018803794 6:167243015-167243037 GAGCAGTTATCTGCAGAAGATGG + Intergenic
1019118634 6:169785742-169785764 TAATAATTATCTGCAGAAGAGGG + Intergenic
1019974902 7:4573384-4573406 GAGTAGTTATTTGCATAAAATGG + Intergenic
1020396715 7:7725490-7725512 GAGTAGTTATCTGCAAAAGATGG - Intronic
1020710347 7:11597601-11597623 GAGTAGTTATCTGCAGAAGATGG - Intronic
1021305095 7:19022551-19022573 GTGTAGTTATCTGCAGAGGATGG + Intronic
1023209081 7:37783713-37783735 AAATAGCTATCTACAAAAGAAGG + Intronic
1023463734 7:40430132-40430154 GTGTAGGTATCTTCACAAGATGG + Intronic
1024040535 7:45550120-45550142 GAGTAGTTATCTGCAGAAGATGG - Intergenic
1024058915 7:45683828-45683850 GAATAGTTACCTGCAAAAGATGG + Intronic
1024377249 7:48653906-48653928 GAGTTCTTATCTGGGAAAGAGGG + Intergenic
1024744204 7:52388413-52388435 GAGTAGTTATCTTCAGAAGATGG - Intergenic
1024866100 7:53906319-53906341 GAGTAGTTATCTGAAAAAGGTGG - Intergenic
1024884344 7:54124679-54124701 GAGTAGCTATCTAAAGAAGATGG + Intergenic
1024932900 7:54682781-54682803 GTTTCCTTATCTGCAAAAGAAGG + Intergenic
1026046491 7:66909123-66909145 GAGTAGTTATATGCAGAAGATGG + Intergenic
1027685794 7:81277930-81277952 GGATAGTTATCTGCAGAAAATGG - Intergenic
1028043858 7:86091441-86091463 GAGTAGTTATCTGCAGAAAAGGG - Intergenic
1028141733 7:87281959-87281981 GAGTAGTTATCTTCAGAAGATGG - Intergenic
1028237818 7:88382796-88382818 GAGTAGTTATCTGCAGAAGATGG - Intergenic
1028935011 7:96455038-96455060 GAGTAATTATCTGCAGAAGATGG - Intergenic
1029961257 7:104691023-104691045 GAGTAGTTATCTGCAGAAGATGG - Intronic
1030277456 7:107736089-107736111 GAGTAGTTATCTGCAGAAGATGG - Intergenic
1030368751 7:108674002-108674024 GAGTAGTTTTCTGCAGAAGATGG - Intergenic
1030457465 7:109793077-109793099 GAGTAGTTATCTGCAGAAGACGG + Intergenic
1030931291 7:115525708-115525730 GAGTAGTTATCTGCGGAAGATGG + Intergenic
1030972179 7:116074005-116074027 GATTATTTACATGCAAAAGAAGG + Intronic
1031474448 7:122205378-122205400 GAGTAGTTATCTGCAGAAGATGG + Intergenic
1031646517 7:124232471-124232493 GAGAAGGTATTTGCAAAAGAGGG + Intergenic
1031646936 7:124237491-124237513 GAGAAGGTATTTGCAAAAGAGGG + Intergenic
1031676556 7:124618324-124618346 AAGTAGTTATCTGCAGAAAATGG - Intergenic
1031700207 7:124915898-124915920 ATCTAGTTATCTGCAAAATAAGG - Intronic
1031709398 7:125026122-125026144 GAGTGGTTATCTTCAAATGTTGG + Intergenic
1031761417 7:125717092-125717114 GAATAGTTATCTGAAAATAATGG - Intergenic
1031832993 7:126649991-126650013 GAGTAGTTATCTGCAGGAGATGG - Intronic
1032153106 7:129446983-129447005 AAGTAGTTATCTGCAGAAGATGG + Intronic
1032233563 7:130099550-130099572 GAGTAGGTGTCAGCAAAGGAGGG + Intronic
1032350099 7:131154190-131154212 TAGTAGTTACCTGTAAAAAATGG + Intronic
1032710561 7:134457175-134457197 GAGTAGTGATTTTCAAATGATGG + Intronic
1034517456 7:151591850-151591872 GAGTCATTATCTGCAGGAGAAGG - Intronic
1036527349 8:9547545-9547567 GAGTAGTTATCCACAGAGGATGG + Intergenic
1037364595 8:18108294-18108316 AGATAGTTATCTGCAGAAGATGG + Intergenic
1037542894 8:19889323-19889345 GTGGAGTTAGCTGCAAAAGTAGG + Intergenic
1037932825 8:22892796-22892818 GGGCAGTAATCAGCAAAAGAGGG + Intronic
1037953614 8:23036076-23036098 GAGTAGTTATCTGCAGAGGATGG - Intronic
1039072016 8:33657455-33657477 GGGTAGGTATATGCAAAATAGGG - Intergenic
1040044436 8:42947786-42947808 GTGTTGTTGTCTGCAAAATAAGG + Intronic
1040911944 8:52528392-52528414 GAGATGTTATCTGCAGAAGATGG - Intergenic
1041236687 8:55810214-55810236 GAGTAGTTTACTGCAAAACATGG + Intronic
1041379139 8:57234655-57234677 GAGTGATTATAAGCAAAAGAAGG + Intergenic
1041986180 8:63924447-63924469 GAGTAGTTATCTTCAGAAGATGG - Intergenic
1042001066 8:64124022-64124044 GAGTAGTTATCTGCAGAAGATGG + Intergenic
1042085614 8:65105664-65105686 GAGTAGTTATCTGCAGAAGATGG + Intergenic
1042342418 8:67694325-67694347 AAGTAGTTATCTGCAGAAAATGG - Intronic
1042779291 8:72472206-72472228 GAGTAGTTACTTGCTGAAGAGGG - Intergenic
1043696631 8:83227609-83227631 GACTACTAATCAGCAAAAGAAGG - Intergenic
1044150799 8:88773049-88773071 GAGTAGTTATCTGCAGAAGATGG - Intergenic
1044285974 8:90412472-90412494 GAGTAGTTATCTGCAGAAGATGG + Intergenic
1044774739 8:95676538-95676560 GAGTAGTTATCTGCAGAGAATGG - Intergenic
1044995785 8:97836853-97836875 AAGCAGTTAGATGCAAAAGAAGG - Intronic
1045221836 8:100207041-100207063 AAGCAGTTATCTGCAGAAGATGG - Intronic
1045935767 8:107677196-107677218 GGGTATTTTTCTGAAAAAGATGG - Intergenic
1045937119 8:107692969-107692991 GGGTATTTTTCTGAAAAAGATGG + Intergenic
1046063986 8:109175188-109175210 AAGTGGTTATCTGCAGAAGATGG + Intergenic
1046197553 8:110884197-110884219 GAGTCGTTATCTGCAGAAGAGGG - Intergenic
1046417641 8:113937820-113937842 GAGTAGTTGTCTGAAGAAGATGG + Intergenic
1046585787 8:116147745-116147767 GAGTAGTTATTTGCAGAAGATGG + Intergenic
1050025928 9:1334565-1334587 GTGTCTTTATCTGCAAAACAAGG + Intergenic
1050482672 9:6102577-6102599 GAGTAGTTATCTGCAGAAGATGG - Intergenic
1050888737 9:10796780-10796802 GACTAGTTATCTGCAGAAGATGG + Intergenic
1051882144 9:21850636-21850658 GAATAGTTATCTGCAGAAGATGG - Intronic
1051966461 9:22834551-22834573 GAGTAGTTACCTGCAGAAGATGG - Intergenic
1052227587 9:26108350-26108372 GAGTAGTTATTTGCAGAAGATGG - Intronic
1052368648 9:27640810-27640832 GAGTAGTTACCTGCAGAAGATGG - Intergenic
1052561528 9:30089783-30089805 GAATAGTTATCTGCAGAAGATGG + Intergenic
1053720704 9:40944043-40944065 GAGTACTTAAAAGCAAAAGAGGG + Intergenic
1053868852 9:42469425-42469447 GAGGAGTTATTCGCAGAAGATGG - Intergenic
1054087438 9:60759755-60759777 GAGGAGTTATTCGCAGAAGATGG + Intergenic
1054345284 9:63908112-63908134 GAGTACTTAAAAGCAAAAGAGGG - Intergenic
1055223481 9:73966376-73966398 GAGTAGTTATCTGCAGATGAGGG - Intergenic
1055903943 9:81271230-81271252 CAGTAGTTATCTGCAGAAGATGG + Intergenic
1056041909 9:82677006-82677028 GAATAGTTAACTGCAGAGGATGG - Intergenic
1056050672 9:82765492-82765514 GAGTAAATATCTTCAAAAGATGG - Intergenic
1056156664 9:83845183-83845205 GAGTAGTTAGCTGCAGAAGATGG - Intronic
1056314236 9:85372971-85372993 GAGTAATTATCTGCTGAAGATGG + Intergenic
1056353874 9:85778344-85778366 GAGTAGTTATCTGCAGAAGATGG + Intergenic
1056986386 9:91367187-91367209 GAGTACTTACCTCCAAAAGGAGG + Intergenic
1057648209 9:96896895-96896917 GAGTAGTTATCAGCGGAAGATGG - Intergenic
1057692730 9:97300624-97300646 GATTAGTTATCTGTAGATGATGG + Intergenic
1058019894 9:100076054-100076076 GAGTAGTTATCTGCAGAAGATGG - Intronic
1058259259 9:102809694-102809716 GAGTAGTTATCTGCAGAAGATGG + Intergenic
1059196507 9:112375894-112375916 GAGTAGTTATCTGCAGAAGAAGG + Intergenic
1060178778 9:121517291-121517313 GAATAGTTATGTGCAGATGATGG - Intergenic
1061713720 9:132505463-132505485 GAGGAGTTATCTGGAAAATGGGG + Intronic
1062135468 9:134924997-134925019 GAGTAGTTATCTGCAGAAGATGG - Intergenic
1186279493 X:7977092-7977114 GAGTAGTTATCTGCAGAAGATGG - Intergenic
1186384096 X:9091788-9091810 GAGTAGTTATCTGCAGAAGATGG + Intronic
1186469769 X:9812135-9812157 GAGTAGTTGTCTGCAGAAGATGG + Intronic
1187604863 X:20871836-20871858 GAGTAGTTATCTGCAGAAGATGG - Intergenic
1187620709 X:21050486-21050508 GACTAGTCATATGCAGAAGATGG + Intergenic
1188099287 X:26063005-26063027 GAGAAGTTATCTGCCATAGCTGG + Intergenic
1188253106 X:27924166-27924188 GAGGAGTAATCTGCAAAAATGGG + Intergenic
1188524291 X:31072229-31072251 GAGCAGTTATTTTTAAAAGATGG - Intergenic
1188741683 X:33791063-33791085 GGATAGTTACATGCAAAAGAAGG - Intergenic
1188757906 X:33987214-33987236 GAGTATTTATGTGCCAATGATGG + Intergenic
1189105340 X:38229829-38229851 GAGCAGTTATCTGCAGAGTATGG - Intronic
1189154886 X:38746748-38746770 GAGTAGTTATTTGCAGAAGATGG + Intergenic
1190721640 X:53153636-53153658 GAGTGGTTATCTGCAGGAGATGG + Intergenic
1190996750 X:55617495-55617517 GAGTAGTTATCTACAGAAGATGG + Intergenic
1191658807 X:63629833-63629855 GAGTAGTTATCTGCTGAAGATGG + Intergenic
1191719243 X:64215736-64215758 GAGTAGTTATCTGCAGAAGATGG + Intergenic
1191742544 X:64451335-64451357 GGGTAGTTATCTGCAGAAGATGG + Intergenic
1191759359 X:64629897-64629919 GAGTAGTTATCTGCAGAAGATGG - Intergenic
1191769499 X:64740125-64740147 GAGTAGTTATTTGCAGAAGAAGG + Intergenic
1192297713 X:69868043-69868065 GAGTAGTTATCTGCAGAAGATGG + Intronic
1192531688 X:71893164-71893186 GTGTAGTTATCTGCAGAGGATGG + Intergenic
1192661565 X:73047789-73047811 GAGTAGTTATCTGCAGAAGATGG + Intergenic
1192673255 X:73168444-73168466 GAATGGTTACCTGCAGAAGATGG + Intergenic
1192774686 X:74230954-74230976 GAGTTCTTTTCTACAAAAGAAGG + Intergenic
1192898701 X:75471882-75471904 GAGTAGTTATCTGCAGAAGATGG - Intronic
1192996190 X:76515550-76515572 GAGTAGTTATCTGCAGAAGATGG - Intergenic
1193053488 X:77125740-77125762 GAGTAGTTTTCTGCAGAAGATGG - Intergenic
1193187370 X:78529175-78529197 GAACAGTTATCTGACAAAGATGG - Intergenic
1193297778 X:79852646-79852668 GAGTAGTTATGTGCAGATGATGG - Intergenic
1193447153 X:81618743-81618765 GAGTAGTTATCTGCAGGAGATGG - Intergenic
1193543674 X:82801354-82801376 GAGTAGTTATCTACAAAGGATGG - Intergenic
1193876038 X:86863890-86863912 GAGTAGTTATCTGTGGAGGATGG - Intergenic
1193904484 X:87225803-87225825 AAGCAGTTATCTGCAGAAGATGG - Intergenic
1193914804 X:87351956-87351978 GAGTAGTTATCTGCAGAAGATGG + Intergenic
1193957281 X:87878182-87878204 GAGAAGTTATCTGCAGAAGGTGG - Intergenic
1194179593 X:90695963-90695985 GAGTAGTTATCTGAAGAAGATGG + Intergenic
1194210276 X:91062326-91062348 GAGTAGTTATCTGCAGAAGATGG - Intergenic
1194343307 X:92731056-92731078 GAGTCGTTATCTGCGGAAGATGG - Intergenic
1194443547 X:93961075-93961097 GAGTAGTTATCTGCAGAAGATGG - Intergenic
1194649420 X:96497844-96497866 GAGTAGTTATCTGTAGATAATGG - Intergenic
1194849248 X:98852202-98852224 GAATAGTTATCTGCAGAAGATGG + Intergenic
1195228466 X:102822243-102822265 GAGTAGTTATCTAGGAAAGATGG - Intergenic
1195653936 X:107316187-107316209 AAGAAGTTATCTGTAAAAGTGGG + Intergenic
1195782356 X:108479893-108479915 GAGTAGTTTTTTGCAGAGGATGG + Intronic
1196135971 X:112209871-112209893 GAGTAGTTATCTGCAGAAGATGG + Intergenic
1197044412 X:121978298-121978320 GAGTAGTTACCTGCAGAATATGG - Intergenic
1197084200 X:122453527-122453549 GAGTAGTTATCTGCAAAGGATGG + Intergenic
1197097465 X:122612810-122612832 GAATAGTTATCTGCAGAAGATGG - Intergenic
1197245048 X:124159022-124159044 GAGTAGTTATCTGCAGAAGATGG + Intronic
1197372059 X:125637894-125637916 GAGTAGTTACCTGCAGAAGATGG + Intergenic
1197380002 X:125727933-125727955 GAGTAGTTTTCTGCAGAAGATGG + Intergenic
1197405085 X:126039170-126039192 GAGCAGTTATGTGCAAAAGATGG - Intergenic
1197409325 X:126096443-126096465 GAGTAGTTATATGCAGAAGATGG + Intergenic
1197521994 X:127510343-127510365 GAGTAGTTATCTGTAGATGGTGG - Intergenic
1198170000 X:134096226-134096248 GAGTAGTTATCTGTGGAGGATGG - Intergenic
1198701297 X:139400268-139400290 GAGTAGTTATCTGCAGAAAATGG - Intergenic
1199008505 X:142730859-142730881 GAGTAGTTATCTCCAGAGGATGG - Intergenic
1199024377 X:142919691-142919713 GAGTACTTATCTGCAGAAGATGG - Intergenic
1199040589 X:143111072-143111094 GAGTAGTTATCTGCAGAAGATGG - Intergenic
1199310429 X:146314428-146314450 GAGTAGTTATCTGCAGAAGAAGG + Intergenic
1199435758 X:147810892-147810914 TAGTAGTTAAATGCAAAAGAGGG - Intergenic
1200526255 Y:4278132-4278154 GAGTAGTTATCTGAAGAAGATGG + Intergenic
1200651667 Y:5847721-5847743 GAGTCGTTATCTGCAGAAGATGG - Intergenic
1200942345 Y:8798159-8798181 GTGTAGTTATCTGGAGAAAAGGG + Intergenic
1200973126 Y:9177738-9177760 GAATATTTATCTACAGAAGATGG + Intergenic
1201303815 Y:12533784-12533806 GAGTGGTTATCTGCACATTATGG + Intergenic
1201796632 Y:17903439-17903461 TACTAGTTATCTGCAGAAAATGG + Intergenic
1201798424 Y:17926671-17926693 CAGTGGTTATCTGCAGAAGATGG - Intergenic
1201803129 Y:17979286-17979308 CAGTGGTTATCTGCAGAAGATGG + Intergenic
1201804923 Y:18002546-18002568 TACTAGTTATCTGCAGAAAATGG - Intergenic
1201888397 Y:18913588-18913610 GAGGATTCATATGCAAAAGAAGG + Intergenic
1202049200 Y:20763254-20763276 GACTAGTAATCTGCATAAAAAGG - Intronic
1202358016 Y:24072501-24072523 TACTAGTTATCTGCAGAAAATGG + Intergenic
1202359744 Y:24095361-24095383 CAATGGTTATCTGCAGAAGATGG - Intergenic
1202511034 Y:25574753-25574775 CAATGGTTATCTGCAGAAGATGG + Intergenic
1202512762 Y:25597612-25597634 TACTAGTTATCTGCAGAAAATGG - Intergenic