ID: 988766414

View in Genome Browser
Species Human (GRCh38)
Location 5:34382305-34382327
Sequence GACAGGTCTTGGCCTATTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988766411_988766414 11 Left 988766411 5:34382271-34382293 CCATCTTTTGCAGATAACTACTC 0: 5
1: 185
2: 202
3: 119
4: 262
Right 988766414 5:34382305-34382327 GACAGGTCTTGGCCTATTACTGG No data
988766410_988766414 15 Left 988766410 5:34382267-34382289 CCTGCCATCTTTTGCAGATAACT No data
Right 988766414 5:34382305-34382327 GACAGGTCTTGGCCTATTACTGG No data
988766409_988766414 16 Left 988766409 5:34382266-34382288 CCCTGCCATCTTTTGCAGATAAC 0: 6
1: 192
2: 177
3: 141
4: 252
Right 988766414 5:34382305-34382327 GACAGGTCTTGGCCTATTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988766414 Original CRISPR GACAGGTCTTGGCCTATTAC TGG Intergenic
No off target data available for this crispr