ID: 988771735

View in Genome Browser
Species Human (GRCh38)
Location 5:34439499-34439521
Sequence GTAGTCCAGCCTTTCTCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988771735_988771740 -8 Left 988771735 5:34439499-34439521 CCCAAAGAGAAAGGCTGGACTAC No data
Right 988771740 5:34439514-34439536 TGGACTACTCTCTTAGGATGGGG No data
988771735_988771739 -9 Left 988771735 5:34439499-34439521 CCCAAAGAGAAAGGCTGGACTAC No data
Right 988771739 5:34439513-34439535 CTGGACTACTCTCTTAGGATGGG No data
988771735_988771738 -10 Left 988771735 5:34439499-34439521 CCCAAAGAGAAAGGCTGGACTAC No data
Right 988771738 5:34439512-34439534 GCTGGACTACTCTCTTAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988771735 Original CRISPR GTAGTCCAGCCTTTCTCTTT GGG (reversed) Intergenic
No off target data available for this crispr