ID: 988772983

View in Genome Browser
Species Human (GRCh38)
Location 5:34450431-34450453
Sequence CATGCATCAGAATCCCCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988772977_988772983 15 Left 988772977 5:34450393-34450415 CCACTACACAGTTCCACTAAACC No data
Right 988772983 5:34450431-34450453 CATGCATCAGAATCCCCTGTGGG No data
988772974_988772983 23 Left 988772974 5:34450385-34450407 CCCTCTTCCCACTACACAGTTCC No data
Right 988772983 5:34450431-34450453 CATGCATCAGAATCCCCTGTGGG No data
988772976_988772983 16 Left 988772976 5:34450392-34450414 CCCACTACACAGTTCCACTAAAC No data
Right 988772983 5:34450431-34450453 CATGCATCAGAATCCCCTGTGGG No data
988772975_988772983 22 Left 988772975 5:34450386-34450408 CCTCTTCCCACTACACAGTTCCA No data
Right 988772983 5:34450431-34450453 CATGCATCAGAATCCCCTGTGGG No data
988772972_988772983 25 Left 988772972 5:34450383-34450405 CCCCCTCTTCCCACTACACAGTT No data
Right 988772983 5:34450431-34450453 CATGCATCAGAATCCCCTGTGGG No data
988772973_988772983 24 Left 988772973 5:34450384-34450406 CCCCTCTTCCCACTACACAGTTC No data
Right 988772983 5:34450431-34450453 CATGCATCAGAATCCCCTGTGGG No data
988772980_988772983 -6 Left 988772980 5:34450414-34450436 CCAGTGGCTCCATTTTGCATGCA No data
Right 988772983 5:34450431-34450453 CATGCATCAGAATCCCCTGTGGG No data
988772979_988772983 2 Left 988772979 5:34450406-34450428 CCACTAAACCAGTGGCTCCATTT No data
Right 988772983 5:34450431-34450453 CATGCATCAGAATCCCCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988772983 Original CRISPR CATGCATCAGAATCCCCTGT GGG Intergenic