ID: 988772996

View in Genome Browser
Species Human (GRCh38)
Location 5:34450519-34450541
Sequence TTGGAGTTCTCCCCTGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988772996_988773004 17 Left 988772996 5:34450519-34450541 CCAGCCCCAGGGGAGAACTCCAA No data
Right 988773004 5:34450559-34450581 CCTTGGCATCAGAGTCACCAAGG No data
988772996_988773001 0 Left 988772996 5:34450519-34450541 CCAGCCCCAGGGGAGAACTCCAA No data
Right 988773001 5:34450542-34450564 ACACTTGTGCCTATTGACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988772996 Original CRISPR TTGGAGTTCTCCCCTGGGGC TGG (reversed) Intergenic