ID: 988772996 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:34450519-34450541 |
| Sequence | TTGGAGTTCTCCCCTGGGGC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 988772996_988773004 | 17 | Left | 988772996 | 5:34450519-34450541 | CCAGCCCCAGGGGAGAACTCCAA | No data | ||
| Right | 988773004 | 5:34450559-34450581 | CCTTGGCATCAGAGTCACCAAGG | No data | ||||
| 988772996_988773001 | 0 | Left | 988772996 | 5:34450519-34450541 | CCAGCCCCAGGGGAGAACTCCAA | No data | ||
| Right | 988773001 | 5:34450542-34450564 | ACACTTGTGCCTATTGACCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 988772996 | Original CRISPR | TTGGAGTTCTCCCCTGGGGC TGG (reversed) | Intergenic | ||