ID: 988772997

View in Genome Browser
Species Human (GRCh38)
Location 5:34450523-34450545
Sequence GTGTTTGGAGTTCTCCCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988772997_988773001 -4 Left 988772997 5:34450523-34450545 CCCCAGGGGAGAACTCCAAACAC No data
Right 988773001 5:34450542-34450564 ACACTTGTGCCTATTGACCTTGG No data
988772997_988773004 13 Left 988772997 5:34450523-34450545 CCCCAGGGGAGAACTCCAAACAC No data
Right 988773004 5:34450559-34450581 CCTTGGCATCAGAGTCACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988772997 Original CRISPR GTGTTTGGAGTTCTCCCCTG GGG (reversed) Intergenic