ID: 988772999

View in Genome Browser
Species Human (GRCh38)
Location 5:34450525-34450547
Sequence AAGTGTTTGGAGTTCTCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988772999_988773001 -6 Left 988772999 5:34450525-34450547 CCAGGGGAGAACTCCAAACACTT No data
Right 988773001 5:34450542-34450564 ACACTTGTGCCTATTGACCTTGG No data
988772999_988773004 11 Left 988772999 5:34450525-34450547 CCAGGGGAGAACTCCAAACACTT No data
Right 988773004 5:34450559-34450581 CCTTGGCATCAGAGTCACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988772999 Original CRISPR AAGTGTTTGGAGTTCTCCCC TGG (reversed) Intergenic
No off target data available for this crispr