ID: 988773000

View in Genome Browser
Species Human (GRCh38)
Location 5:34450538-34450560
Sequence GGTCAATAGGCACAAGTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988773000_988773006 25 Left 988773000 5:34450538-34450560 CCAAACACTTGTGCCTATTGACC No data
Right 988773006 5:34450586-34450608 CAGTGCAGTCAAGCACTGAAAGG No data
988773000_988773004 -2 Left 988773000 5:34450538-34450560 CCAAACACTTGTGCCTATTGACC No data
Right 988773004 5:34450559-34450581 CCTTGGCATCAGAGTCACCAAGG No data
988773000_988773007 26 Left 988773000 5:34450538-34450560 CCAAACACTTGTGCCTATTGACC No data
Right 988773007 5:34450587-34450609 AGTGCAGTCAAGCACTGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988773000 Original CRISPR GGTCAATAGGCACAAGTGTT TGG (reversed) Intergenic