ID: 988773001

View in Genome Browser
Species Human (GRCh38)
Location 5:34450542-34450564
Sequence ACACTTGTGCCTATTGACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988772998_988773001 -5 Left 988772998 5:34450524-34450546 CCCAGGGGAGAACTCCAAACACT No data
Right 988773001 5:34450542-34450564 ACACTTGTGCCTATTGACCTTGG No data
988772997_988773001 -4 Left 988772997 5:34450523-34450545 CCCCAGGGGAGAACTCCAAACAC No data
Right 988773001 5:34450542-34450564 ACACTTGTGCCTATTGACCTTGG No data
988772999_988773001 -6 Left 988772999 5:34450525-34450547 CCAGGGGAGAACTCCAAACACTT No data
Right 988773001 5:34450542-34450564 ACACTTGTGCCTATTGACCTTGG No data
988772996_988773001 0 Left 988772996 5:34450519-34450541 CCAGCCCCAGGGGAGAACTCCAA No data
Right 988773001 5:34450542-34450564 ACACTTGTGCCTATTGACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988773001 Original CRISPR ACACTTGTGCCTATTGACCT TGG Intergenic