ID: 988773004

View in Genome Browser
Species Human (GRCh38)
Location 5:34450559-34450581
Sequence CCTTGGCATCAGAGTCACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988773000_988773004 -2 Left 988773000 5:34450538-34450560 CCAAACACTTGTGCCTATTGACC No data
Right 988773004 5:34450559-34450581 CCTTGGCATCAGAGTCACCAAGG No data
988772996_988773004 17 Left 988772996 5:34450519-34450541 CCAGCCCCAGGGGAGAACTCCAA No data
Right 988773004 5:34450559-34450581 CCTTGGCATCAGAGTCACCAAGG No data
988772999_988773004 11 Left 988772999 5:34450525-34450547 CCAGGGGAGAACTCCAAACACTT No data
Right 988773004 5:34450559-34450581 CCTTGGCATCAGAGTCACCAAGG No data
988772997_988773004 13 Left 988772997 5:34450523-34450545 CCCCAGGGGAGAACTCCAAACAC No data
Right 988773004 5:34450559-34450581 CCTTGGCATCAGAGTCACCAAGG No data
988772998_988773004 12 Left 988772998 5:34450524-34450546 CCCAGGGGAGAACTCCAAACACT No data
Right 988773004 5:34450559-34450581 CCTTGGCATCAGAGTCACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988773004 Original CRISPR CCTTGGCATCAGAGTCACCA AGG Intergenic