ID: 988776111

View in Genome Browser
Species Human (GRCh38)
Location 5:34479354-34479376
Sequence CTGGTTGCCCAGCTAGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988776103_988776111 18 Left 988776103 5:34479313-34479335 CCACAGCAAAGCCAGAGAGTCAG No data
Right 988776111 5:34479354-34479376 CTGGTTGCCCAGCTAGAGCAAGG No data
988776105_988776111 7 Left 988776105 5:34479324-34479346 CCAGAGAGTCAGGCATGCCCCAC No data
Right 988776111 5:34479354-34479376 CTGGTTGCCCAGCTAGAGCAAGG No data
988776107_988776111 -10 Left 988776107 5:34479341-34479363 CCCCACACCGTTGCTGGTTGCCC No data
Right 988776111 5:34479354-34479376 CTGGTTGCCCAGCTAGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988776111 Original CRISPR CTGGTTGCCCAGCTAGAGCA AGG Intergenic
No off target data available for this crispr