ID: 988780517

View in Genome Browser
Species Human (GRCh38)
Location 5:34516934-34516956
Sequence CTGAAGGAAATGAGGCAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988780517_988780521 8 Left 988780517 5:34516934-34516956 CCTTGCTGCCTCATTTCCTTCAG No data
Right 988780521 5:34516965-34516987 TCGGATACCGCTTATCAAAGAGG No data
988780517_988780523 30 Left 988780517 5:34516934-34516956 CCTTGCTGCCTCATTTCCTTCAG No data
Right 988780523 5:34516987-34517009 GACTTCTCTGACCATCCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988780517 Original CRISPR CTGAAGGAAATGAGGCAGCA AGG (reversed) Intergenic
No off target data available for this crispr