ID: 988787585

View in Genome Browser
Species Human (GRCh38)
Location 5:34578976-34578998
Sequence CTGGAGTGGCCTGGGGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988787585_988787593 5 Left 988787585 5:34578976-34578998 CCTGCAGCCCCAGGCCACTCCAG No data
Right 988787593 5:34579004-34579026 CCCTCACTGCTCTCCACTCTGGG No data
988787585_988787596 22 Left 988787585 5:34578976-34578998 CCTGCAGCCCCAGGCCACTCCAG No data
Right 988787596 5:34579021-34579043 TCTGGGCCTGAACTTCCAGAAGG No data
988787585_988787591 4 Left 988787585 5:34578976-34578998 CCTGCAGCCCCAGGCCACTCCAG No data
Right 988787591 5:34579003-34579025 TCCCTCACTGCTCTCCACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988787585 Original CRISPR CTGGAGTGGCCTGGGGCTGC AGG (reversed) Intergenic
No off target data available for this crispr