ID: 988792651

View in Genome Browser
Species Human (GRCh38)
Location 5:34622888-34622910
Sequence TGGAAGCCCCAAAATGATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988792649_988792651 -8 Left 988792649 5:34622873-34622895 CCCAAAGGGGAAGATTGGAAGCC No data
Right 988792651 5:34622888-34622910 TGGAAGCCCCAAAATGATCCAGG No data
988792639_988792651 30 Left 988792639 5:34622835-34622857 CCATGCCCAACCCAAGCATGTAA No data
Right 988792651 5:34622888-34622910 TGGAAGCCCCAAAATGATCCAGG No data
988792643_988792651 20 Left 988792643 5:34622845-34622867 CCCAAGCATGTAAAATGGAAGAA No data
Right 988792651 5:34622888-34622910 TGGAAGCCCCAAAATGATCCAGG No data
988792650_988792651 -9 Left 988792650 5:34622874-34622896 CCAAAGGGGAAGATTGGAAGCCC No data
Right 988792651 5:34622888-34622910 TGGAAGCCCCAAAATGATCCAGG No data
988792644_988792651 19 Left 988792644 5:34622846-34622868 CCAAGCATGTAAAATGGAAGAAA No data
Right 988792651 5:34622888-34622910 TGGAAGCCCCAAAATGATCCAGG No data
988792640_988792651 25 Left 988792640 5:34622840-34622862 CCCAACCCAAGCATGTAAAATGG No data
Right 988792651 5:34622888-34622910 TGGAAGCCCCAAAATGATCCAGG No data
988792642_988792651 24 Left 988792642 5:34622841-34622863 CCAACCCAAGCATGTAAAATGGA No data
Right 988792651 5:34622888-34622910 TGGAAGCCCCAAAATGATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988792651 Original CRISPR TGGAAGCCCCAAAATGATCC AGG Intergenic
No off target data available for this crispr