ID: 988793124

View in Genome Browser
Species Human (GRCh38)
Location 5:34627317-34627339
Sequence TCTAGGGACTCTAAGTGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988793124_988793128 -4 Left 988793124 5:34627317-34627339 CCAAGGCACTTAGAGTCCCTAGA No data
Right 988793128 5:34627336-34627358 TAGAGCAAAAATTGGAAACTAGG No data
988793124_988793129 1 Left 988793124 5:34627317-34627339 CCAAGGCACTTAGAGTCCCTAGA No data
Right 988793129 5:34627341-34627363 CAAAAATTGGAAACTAGGCATGG No data
988793124_988793131 22 Left 988793124 5:34627317-34627339 CCAAGGCACTTAGAGTCCCTAGA No data
Right 988793131 5:34627362-34627384 GGTAGAAGATGAGGCTGAAGAGG No data
988793124_988793130 13 Left 988793124 5:34627317-34627339 CCAAGGCACTTAGAGTCCCTAGA No data
Right 988793130 5:34627353-34627375 ACTAGGCATGGTAGAAGATGAGG No data
988793124_988793132 25 Left 988793124 5:34627317-34627339 CCAAGGCACTTAGAGTCCCTAGA No data
Right 988793132 5:34627365-34627387 AGAAGATGAGGCTGAAGAGGAGG No data
988793124_988793133 26 Left 988793124 5:34627317-34627339 CCAAGGCACTTAGAGTCCCTAGA No data
Right 988793133 5:34627366-34627388 GAAGATGAGGCTGAAGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988793124 Original CRISPR TCTAGGGACTCTAAGTGCCT TGG (reversed) Intergenic
No off target data available for this crispr