ID: 988795703

View in Genome Browser
Species Human (GRCh38)
Location 5:34651537-34651559
Sequence CAGAACGGGGAGAAGTAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 159}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988795697_988795703 30 Left 988795697 5:34651484-34651506 CCAAGGCTGATGTCGCTTGGGTC 0: 1
1: 0
2: 0
3: 5
4: 59
Right 988795703 5:34651537-34651559 CAGAACGGGGAGAAGTAATGAGG 0: 1
1: 0
2: 0
3: 8
4: 159
988795698_988795703 8 Left 988795698 5:34651506-34651528 CCTAAGTGCTCTCATAGCAGTCT 0: 1
1: 0
2: 2
3: 11
4: 143
Right 988795703 5:34651537-34651559 CAGAACGGGGAGAAGTAATGAGG 0: 1
1: 0
2: 0
3: 8
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988795703 Original CRISPR CAGAACGGGGAGAAGTAATG AGG Intergenic
902108898 1:14061257-14061279 GGGAACAGGGAGGAGTAATGGGG + Intergenic
903772149 1:25770717-25770739 CAGAGAGGGGAGAAGGAAAGTGG - Intronic
904663972 1:32105910-32105932 CAGAACAGGGCAAAGTGATGAGG + Intergenic
906199085 1:43947670-43947692 GAGAACGTGGAGAAGGTATGAGG + Exonic
909353292 1:74678554-74678576 CAGAATGGTGAGAAATAATCAGG - Intergenic
909869119 1:80717202-80717224 CAGAACGGGGATTAGTAACTTGG + Intergenic
911348272 1:96722165-96722187 CAGACCGGGGAGACGTTATGGGG - Intronic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
917785533 1:178452511-178452533 CAGAAAACGGAGAAATAATGAGG - Exonic
919122040 1:193353547-193353569 CAGCACGGTGAGAACTATTGAGG + Intergenic
920110891 1:203586347-203586369 CAGAAACGGGAGAAGTAAGTGGG - Intergenic
923311689 1:232741878-232741900 AGGAAAGGGGAGAAATAATGAGG - Intergenic
1064229830 10:13520336-13520358 CACCACAGGGAGAAGGAATGGGG - Intronic
1064300610 10:14119527-14119549 CAGATCAGGGAGCAGTAGTGAGG + Intronic
1065342088 10:24717116-24717138 CAGTATTGGGAGAAGAAATGAGG + Intronic
1065652845 10:27911588-27911610 CATAACGGGGAGAAGCTCTGTGG - Intronic
1067661433 10:48238793-48238815 CAGATCAGGGAGAAGAACTGTGG - Intronic
1069103242 10:64350676-64350698 CAGTAGGAGGAGATGTAATGAGG + Intergenic
1070539692 10:77407183-77407205 CAGGACTGGGAGGAGTGATGGGG + Intronic
1073644085 10:105281678-105281700 CAGAAAGGTGAGAAGTAAATAGG - Intergenic
1074752193 10:116597474-116597496 AAGAAAGGGGTGAAGCAATGTGG - Intronic
1076444841 10:130507370-130507392 CCACATGGGGAGAAGTAATGAGG - Intergenic
1077847300 11:6039524-6039546 CAGAACCAGGAGAAGGAAGGAGG - Intergenic
1078462147 11:11522187-11522209 CAGAATGAGGAGAGGTCATGTGG - Intronic
1078513578 11:12004917-12004939 AACAAAGGGGAGAAGAAATGGGG + Intronic
1085462393 11:76701996-76702018 CAGAACGAGGAGAAGGGTTGGGG + Intergenic
1087402843 11:97689440-97689462 GAGGAAGGGGAGAAATAATGTGG - Intergenic
1087744152 11:101923903-101923925 CAGAAAGGGTAGAAATAAAGTGG + Intronic
1089055912 11:115584666-115584688 GAGAAGAGGAAGAAGTAATGAGG + Intergenic
1091532616 12:1374296-1374318 CAGAAAGAGGTGAAGCAATGAGG + Intronic
1095341689 12:41097202-41097224 GAGAAATGGGAGAATTAATGAGG + Intergenic
1098860603 12:75705849-75705871 CAGAATGGGGAAATGGAATGAGG - Intergenic
1099405954 12:82262758-82262780 CAGAAGGGGAAGAACTGATGTGG + Intronic
1101045009 12:100795626-100795648 CAGAAGGGAAAGAAGCAATGAGG - Intronic
1103164306 12:118757105-118757127 AAGAAAGGGGAGAAGGAAGGAGG + Intergenic
1103376700 12:120462029-120462051 CTGAAAGGAGAGAAGTAGTGTGG + Exonic
1104090255 12:125510718-125510740 GAGAAGGGAGAGAAATAATGAGG - Intronic
1105462737 13:20607259-20607281 CAGTACGGGTAGAAGTGCTGCGG - Intronic
1106952938 13:34905109-34905131 CACAAAGGGAAGAATTAATGGGG + Intergenic
1107333086 13:39322692-39322714 CAGAAGGGAGAGAAGGAAGGAGG + Intergenic
1109272836 13:60273449-60273471 AAGAACTGGGAGCATTAATGGGG - Intergenic
1110163422 13:72407487-72407509 CAGAAAGGAGAGAAATAAAGAGG - Intergenic
1112930679 13:104732520-104732542 CAGAAGGAGGAGAAGAAAAGGGG - Intergenic
1117702029 14:58423727-58423749 GAGAACAGGTAGCAGTAATGTGG + Intronic
1117845392 14:59906283-59906305 AAAAAGGGGGAGAAGTATTGAGG - Intergenic
1119216877 14:72876098-72876120 CAGAAAGGGAAGAAGTCATTTGG + Intronic
1119269213 14:73287235-73287257 CAGAAGCGGGAGAAGGAATGTGG - Exonic
1125927058 15:43571644-43571666 CAGTACAGGGAGAAGTAAAAGGG - Intronic
1125940202 15:43671209-43671231 CAGTACAGGGAGAAGTAAAAGGG - Intergenic
1126821766 15:52511379-52511401 CTGAATCAGGAGAAGTAATGTGG - Intronic
1127298390 15:57629897-57629919 GAGAAAAGGGAGAAGTAAAGAGG - Intronic
1128595350 15:68941583-68941605 CAGAAGAGGAAGAGGTAATGTGG - Intronic
1131122219 15:89829700-89829722 CAGAAGGGGAAGAGGAAATGAGG - Intergenic
1131320001 15:91379194-91379216 CAAAATGTGGAGAAGCAATGGGG - Intergenic
1132272296 15:100537094-100537116 CAGAACTGGGAGAACTACTTGGG + Intronic
1135883062 16:26278132-26278154 AAGAACGGGGAGAATAAAAGAGG + Intergenic
1139482381 16:67237578-67237600 CAGAAAGTGGAGCAGTCATGGGG + Intronic
1140856611 16:78983500-78983522 GAGGAAGGGGAGAAGAAATGGGG + Intronic
1142638817 17:1273177-1273199 CAGAACTGAAAGAAGTAAGGGGG + Intergenic
1147264650 17:39227383-39227405 CAGAAGGGGCAGAAGGAAAGAGG - Intergenic
1148492672 17:48033388-48033410 CAGAAAGGGGAGAAGGAAATAGG - Intronic
1152537899 17:80961016-80961038 CAGATCGGGGAGACACAATGAGG + Intronic
1153534207 18:6083303-6083325 CAGAACGAGCATAAGTAACGTGG + Intronic
1155325715 18:24662968-24662990 GAGAATGGGGAGAAGGAAAGAGG - Intergenic
1158580413 18:58676122-58676144 CAAAACAGGGAGAAGTTAAGTGG - Intronic
1161057381 19:2197497-2197519 CAGAAGGGGGAGCAGTGCTGCGG - Intronic
1164754596 19:30680143-30680165 CACACCGGGGACAAGAAATGGGG + Intronic
1168416455 19:56172145-56172167 GAGGAGGGGGAGAAGGAATGGGG + Intergenic
925480111 2:4261266-4261288 CAGAACAGGGACATGTACTGGGG + Intergenic
925723088 2:6847050-6847072 CAGAAGGGGGAGCTCTAATGGGG + Intronic
928071403 2:28221180-28221202 CAGAAAGGGGAGAAGTTTAGAGG - Intronic
929343319 2:40849839-40849861 CAGAAGGGGGAGAAATGATATGG - Intergenic
929918100 2:46153000-46153022 CAGAGGGGAGAGAAGGAATGAGG - Intronic
932314353 2:70769550-70769572 GAGAATGGGGAGAAGTCTTGTGG - Intergenic
937617230 2:123940454-123940476 CAGATCATGGAGAAGAAATGAGG - Intergenic
938995269 2:136671812-136671834 CAGAATGAAGAGAAGTCATGGGG + Intergenic
941655497 2:168139736-168139758 CAGAACTAAGAGAAATAATGAGG + Intronic
943132704 2:183874688-183874710 CAGATGGGGGAGAGGTAATTGGG - Intergenic
944689944 2:202149657-202149679 AAGGAGTGGGAGAAGTAATGAGG + Intronic
944975285 2:205042820-205042842 CAGGACAGGGAGAAGGGATGAGG - Intronic
1168974428 20:1953393-1953415 CAGAAAGAGGAGAATGAATGGGG - Intergenic
1171948164 20:31396870-31396892 CAGAACTGGGAGAGGAGATGGGG - Intergenic
1175109545 20:56637428-56637450 CAGGACTGGTAAAAGTAATGGGG - Intronic
1175156666 20:56976169-56976191 CAGATCGGGGAGAAGCATGGAGG + Intergenic
1175255602 20:57645065-57645087 CAGAATTGGCATAAGTAATGAGG + Intergenic
1177359045 21:20045500-20045522 CAGAAGTGGCAGAAGTAGTGTGG - Intergenic
1178446522 21:32648448-32648470 CAGAAAGATGAGAAGAAATGAGG - Intronic
1180713958 22:17858975-17858997 CAGAAGGGAGAGAAGGAATTGGG - Intronic
1182780954 22:32867227-32867249 CAGAAAGAGGATAGGTAATGTGG - Intronic
952001129 3:28786916-28786938 CAGAACAGAGAGAAAGAATGGGG - Intergenic
952762831 3:36930233-36930255 CGGAGCGGGGAGGAGTGATGAGG + Intronic
955925416 3:63999478-63999500 TAGCACGGGGAGGAATAATGCGG + Exonic
960095487 3:113685909-113685931 CAGAAGAGGGAAAAGTAAAGAGG - Intronic
960190978 3:114705790-114705812 CAGCACTGGGAGATGTCATGTGG + Intronic
960402365 3:117217297-117217319 CAGAATGGGGAAAAATAACGTGG + Intergenic
961854434 3:129855512-129855534 CAGAAAAAGGAGAAGAAATGAGG + Intronic
963789342 3:149567621-149567643 CAGAAAGGGGAGGAAAAATGAGG + Intronic
964217330 3:154300803-154300825 CAGATCGGAGAGAATTACTGGGG + Intronic
967466747 3:189815068-189815090 AAGAAGGGGGAGAAGAAATGCGG - Intronic
967902525 3:194470884-194470906 CAGAACTGGCAGAAGTAAAATGG + Intronic
968002830 3:195219486-195219508 CAGGAAGGGAAGAAGGAATGAGG + Intronic
969302302 4:6304262-6304284 CAGAATGGGGAGAGGAAATGAGG - Intergenic
973263590 4:48187936-48187958 CAGAAAGGGGAGGAAAAATGTGG - Intronic
975464558 4:74694579-74694601 AAGAACCAGGAGAATTAATGTGG - Intergenic
976052191 4:81022360-81022382 CAGACAGGGGAGAAGGAAAGAGG + Intergenic
979114169 4:116800077-116800099 CAAACAGGGGAGAATTAATGAGG - Intergenic
979572994 4:122252264-122252286 AAGCAGAGGGAGAAGTAATGGGG + Intronic
980232326 4:130060942-130060964 CAGAAAGGGGAGAAGAAATAGGG - Intergenic
986707985 5:10467147-10467169 GAGGGCTGGGAGAAGTAATGTGG - Intronic
988795703 5:34651537-34651559 CAGAACGGGGAGAAGTAATGAGG + Intergenic
989986943 5:50712015-50712037 CAGAAGTGGAAGAAGTAATGAGG - Intronic
990531421 5:56677380-56677402 GAGAGCTGGGAGAAGTAATGTGG - Intergenic
990660557 5:58009697-58009719 CAGAATGGGGAAAAGCAAAGTGG + Intergenic
994508149 5:100667843-100667865 CAGCACAGAAAGAAGTAATGAGG - Intergenic
996008946 5:118459012-118459034 CAGAACCGTGAGAAAGAATGGGG + Intergenic
997137671 5:131343835-131343857 CACAAGTGGGAGAAGAAATGTGG + Intronic
997182669 5:131846880-131846902 CTGAAAGGGGTGAAGTAAAGGGG + Intronic
997839171 5:137222942-137222964 CAGAAAGGGGAGAGGCAATTAGG + Intronic
998124990 5:139612416-139612438 GAGAAGGGGGATAAGTAAGGGGG - Intronic
1002860125 6:1072721-1072743 AAGAAGGGGGAGAAGTAAGTGGG + Intergenic
1003045762 6:2731441-2731463 CAGCATGGGGTGAAGGAATGCGG - Intronic
1003209940 6:4053658-4053680 CAAAACAGGGTAAAGTAATGGGG - Intronic
1004286095 6:14322279-14322301 CAGAAAGGGGAGAAGCCAAGCGG + Intergenic
1004728252 6:18332025-18332047 CAGAACGGGGAGAATGGGTGAGG + Intergenic
1004801219 6:19150586-19150608 CAGAATGGGGTGATGGAATGTGG + Intergenic
1006571778 6:35011487-35011509 AAGAAGGGGGAGATGTAATGAGG + Intronic
1006716630 6:36124556-36124578 GAGAAGGGGAAGAGGTAATGGGG + Intergenic
1008309746 6:49952309-49952331 CAGCAGGTGGAGAAGGAATGTGG - Intergenic
1009990992 6:70842753-70842775 CAGAATGAGGAGAAGCAAAGAGG - Intronic
1010142102 6:72623016-72623038 TAGGACGGGGAGAAGTGAGGGGG + Intronic
1010928066 6:81767643-81767665 CAGGAGGTGGAGAAGAAATGTGG + Intergenic
1011180966 6:84620198-84620220 CAGAAGCTGGAGAAGTGATGGGG - Intergenic
1011203990 6:84871973-84871995 CAGGAAGGTAAGAAGTAATGTGG + Intergenic
1012224496 6:96688757-96688779 CAGTACAGGGAAAAGTAAAGGGG + Intergenic
1012806394 6:103898841-103898863 AAGAACGGGGAGAGGGAAGGAGG + Intergenic
1013141589 6:107341349-107341371 AAGAAGGAGGAGAACTAATGAGG + Intronic
1014357497 6:120431550-120431572 CACATGGGGGAGCAGTAATGAGG - Intergenic
1015273276 6:131358742-131358764 CTGTATGGGAAGAAGTAATGAGG + Intergenic
1019778375 7:2925684-2925706 CAGGATGGGGAGAAGTAGGGAGG - Intronic
1019919992 7:4157370-4157392 AAGAAGGGAGAGAAGGAATGAGG + Intronic
1019940423 7:4284854-4284876 CAGAACAGGGTTCAGTAATGGGG + Intergenic
1020530171 7:9323159-9323181 AAGAATGGGGAGAAGGAAGGAGG + Intergenic
1020821847 7:12979721-12979743 CAGGAAGGGAAGAAATAATGTGG - Intergenic
1021226198 7:18029264-18029286 CAGAAATGGGATAAGAAATGGGG + Intergenic
1021231151 7:18087138-18087160 GAGAAGGGGGAGAAGTTAAGAGG + Intronic
1022256632 7:28664875-28664897 CAGAACAGGTACAAATAATGAGG + Intronic
1023562861 7:41494087-41494109 CAGAAAAGGGAGATGTAATTAGG - Intergenic
1024004005 7:45212183-45212205 AAGAAAGGGGAGAAGGACTGGGG - Intergenic
1028070769 7:86447326-86447348 CAGAACAGAAAGAAGTAGTGAGG + Intergenic
1028232634 7:88323860-88323882 CAGAATGGGGAGGAGTTTTGAGG + Intergenic
1031831562 7:126633209-126633231 CATAAAGTGGAGAAGAAATGTGG + Intronic
1042811209 8:72827234-72827256 AAGAAAGGGGAGAAGTAACTTGG + Intronic
1043446444 8:80324221-80324243 CAGAGCTGGGAGAAGAACTGGGG + Intergenic
1043670830 8:82882101-82882123 CACAACAGGGACAAGGAATGGGG - Intergenic
1047298489 8:123592003-123592025 CAGAAGGGGAAGAATTAGTGTGG + Intergenic
1047765852 8:127989435-127989457 CAGGTCGGGGAGAGGTTATGGGG - Intergenic
1048468722 8:134688529-134688551 GAGAAAGGGGAGAAGGAAGGTGG + Intronic
1050022308 9:1296972-1296994 CAGAACTGGAAGAAATAATATGG + Intergenic
1052607437 9:30723058-30723080 AAGCAGGGGGAGAAGTAAAGGGG + Intergenic
1058092753 9:100824367-100824389 CAGAATGGGGTTAAATAATGGGG - Intergenic
1060051183 9:120379493-120379515 CAGAGCGGGGAGATGCAGTGAGG + Intergenic
1061423309 9:130483890-130483912 CAGAAAGTGGAGGAGTAAGGAGG - Intronic
1189270202 X:39746280-39746302 CAGAAGGGGGAGACGTGGTGAGG - Intergenic
1192376812 X:70570732-70570754 CAAAAAGCTGAGAAGTAATGGGG + Intronic
1196135030 X:112199534-112199556 CAGAAAGGGGAGATAGAATGAGG - Intergenic
1196227832 X:113187844-113187866 AAGAAGGAGGAGAAGTGATGTGG + Intergenic
1198553822 X:137772008-137772030 CAGAACAGGAAGAAGTTCTGTGG + Intergenic
1201110788 Y:10797845-10797867 AAGAACGGAGAGAAGTGTTGAGG - Intergenic