ID: 988796318

View in Genome Browser
Species Human (GRCh38)
Location 5:34656374-34656396
Sequence CGCCGGGCTCGCTTCCTGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 96}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988796318_988796320 -8 Left 988796318 5:34656374-34656396 CCGAGCAGGAAGCGAGCCCGGCG 0: 1
1: 0
2: 0
3: 7
4: 96
Right 988796320 5:34656389-34656411 GCCCGGCGGCCGCGTTTTCCTGG 0: 1
1: 0
2: 1
3: 10
4: 109
988796318_988796325 0 Left 988796318 5:34656374-34656396 CCGAGCAGGAAGCGAGCCCGGCG 0: 1
1: 0
2: 0
3: 7
4: 96
Right 988796325 5:34656397-34656419 GCCGCGTTTTCCTGGGGAAGCGG 0: 1
1: 0
2: 0
3: 14
4: 351
988796318_988796333 12 Left 988796318 5:34656374-34656396 CCGAGCAGGAAGCGAGCCCGGCG 0: 1
1: 0
2: 0
3: 7
4: 96
Right 988796333 5:34656409-34656431 TGGGGAAGCGGCGGGCGGGGTGG 0: 1
1: 1
2: 1
3: 104
4: 967
988796318_988796330 8 Left 988796318 5:34656374-34656396 CCGAGCAGGAAGCGAGCCCGGCG 0: 1
1: 0
2: 0
3: 7
4: 96
Right 988796330 5:34656405-34656427 TTCCTGGGGAAGCGGCGGGCGGG 0: 1
1: 0
2: 2
3: 16
4: 284
988796318_988796329 7 Left 988796318 5:34656374-34656396 CCGAGCAGGAAGCGAGCCCGGCG 0: 1
1: 0
2: 0
3: 7
4: 96
Right 988796329 5:34656404-34656426 TTTCCTGGGGAAGCGGCGGGCGG 0: 1
1: 0
2: 1
3: 16
4: 244
988796318_988796324 -6 Left 988796318 5:34656374-34656396 CCGAGCAGGAAGCGAGCCCGGCG 0: 1
1: 0
2: 0
3: 7
4: 96
Right 988796324 5:34656391-34656413 CCGGCGGCCGCGTTTTCCTGGGG 0: 1
1: 0
2: 0
3: 4
4: 44
988796318_988796328 4 Left 988796318 5:34656374-34656396 CCGAGCAGGAAGCGAGCCCGGCG 0: 1
1: 0
2: 0
3: 7
4: 96
Right 988796328 5:34656401-34656423 CGTTTTCCTGGGGAAGCGGCGGG 0: 1
1: 0
2: 0
3: 15
4: 159
988796318_988796335 26 Left 988796318 5:34656374-34656396 CCGAGCAGGAAGCGAGCCCGGCG 0: 1
1: 0
2: 0
3: 7
4: 96
Right 988796335 5:34656423-34656445 GCGGGGTGGAGCAGCCAGCTGGG 0: 1
1: 0
2: 2
3: 17
4: 229
988796318_988796322 -7 Left 988796318 5:34656374-34656396 CCGAGCAGGAAGCGAGCCCGGCG 0: 1
1: 0
2: 0
3: 7
4: 96
Right 988796322 5:34656390-34656412 CCCGGCGGCCGCGTTTTCCTGGG 0: 1
1: 0
2: 0
3: 6
4: 47
988796318_988796331 9 Left 988796318 5:34656374-34656396 CCGAGCAGGAAGCGAGCCCGGCG 0: 1
1: 0
2: 0
3: 7
4: 96
Right 988796331 5:34656406-34656428 TCCTGGGGAAGCGGCGGGCGGGG 0: 1
1: 0
2: 5
3: 20
4: 311
988796318_988796334 25 Left 988796318 5:34656374-34656396 CCGAGCAGGAAGCGAGCCCGGCG 0: 1
1: 0
2: 0
3: 7
4: 96
Right 988796334 5:34656422-34656444 GGCGGGGTGGAGCAGCCAGCTGG 0: 1
1: 0
2: 3
3: 38
4: 371
988796318_988796327 3 Left 988796318 5:34656374-34656396 CCGAGCAGGAAGCGAGCCCGGCG 0: 1
1: 0
2: 0
3: 7
4: 96
Right 988796327 5:34656400-34656422 GCGTTTTCCTGGGGAAGCGGCGG 0: 1
1: 0
2: 1
3: 15
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988796318 Original CRISPR CGCCGGGCTCGCTTCCTGCT CGG (reversed) Intronic