ID: 988796322

View in Genome Browser
Species Human (GRCh38)
Location 5:34656390-34656412
Sequence CCCGGCGGCCGCGTTTTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 47}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988796318_988796322 -7 Left 988796318 5:34656374-34656396 CCGAGCAGGAAGCGAGCCCGGCG 0: 1
1: 0
2: 0
3: 7
4: 96
Right 988796322 5:34656390-34656412 CCCGGCGGCCGCGTTTTCCTGGG 0: 1
1: 0
2: 0
3: 6
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988796322 Original CRISPR CCCGGCGGCCGCGTTTTCCT GGG Intronic
900256134 1:1699225-1699247 CCCGGCGCCCGCGTCTTCCACGG - Intronic
900264802 1:1751835-1751857 CCCGGCGCCCGCGTCTTCCACGG - Exonic
914870593 1:151470588-151470610 CCCTGAGGCCCCGCTTTCCTGGG - Intergenic
917846892 1:179026637-179026659 CCCGGGGCCCGCGGTCTCCTGGG + Intronic
1076855730 10:133114878-133114900 CCCTGAGGCTGCGGTTTCCTTGG + Intronic
1081872658 11:46390643-46390665 CTCGAGGGCCGTGTTTTCCTAGG + Intergenic
1095983596 12:47985937-47985959 CCCGGCAACCGCGGTTTCCCAGG - Exonic
1110630109 13:77697883-77697905 CCCGGCGGCCGCGGCGCCCTCGG + Intronic
1124256217 15:28145028-28145050 CCCGCCTGCCGCAGTTTCCTGGG - Intronic
1127931846 15:63601995-63602017 CCCGGCAGCCGCCTGGTCCTGGG + Exonic
1132678237 16:1129463-1129485 CCCTGCTGCGGGGTTTTCCTGGG + Intergenic
1132994915 16:2817796-2817818 CCCGTCGGCCGCATGGTCCTCGG - Exonic
1140451927 16:75077777-75077799 CCTGGAGGCCACGCTTTCCTTGG + Intronic
1147402823 17:40191339-40191361 CCCGGCGGCCGCGCTCCCCGTGG - Exonic
1148489186 17:48012374-48012396 CCCGGAGGCCGCGGTTGCCATGG + Intergenic
1151820684 17:76495139-76495161 CCCGGCAGCCGGGTTTTCACGGG + Intronic
1155059889 18:22219191-22219213 CCCTGCGGCCTCGACTTCCTGGG + Intergenic
1160005163 18:75063858-75063880 CACGGCGGCCGGGCTCTCCTGGG - Exonic
1160750343 19:731148-731170 CGGGGCCGCCGCGTTCTCCTTGG - Exonic
1160874435 19:1290610-1290632 CCCGGTGGCCGTGTGTTCCCCGG + Intronic
1162033187 19:7925997-7926019 CCCGGCGGCCGCGCTCTCTCAGG + Exonic
1164644174 19:29845655-29845677 CCCGCCGGCCGGGTGTTCCACGG + Intergenic
927055450 2:19361826-19361848 CCCTGCTGCCGCCTTTTCCTGGG + Intergenic
927215846 2:20667425-20667447 CCCGGCCGCCGCGGTTCCCCGGG + Exonic
927990920 2:27446338-27446360 CCTGGCAGCCACGGTTTCCTGGG + Exonic
941987296 2:171522317-171522339 CTCGGCGGCCGCGTGATCCCGGG + Intronic
1170524865 20:17227325-17227347 CCCGGCGGCCGCCTTCCACTGGG - Exonic
1171417377 20:24992346-24992368 CCCAGTCGCCGCGTTGTCCTCGG - Intronic
1175245794 20:57581250-57581272 CCGGGCTGCCGCGTGTTCCTGGG + Intergenic
1175429126 20:58890317-58890339 CCCGGCGGCGGCGCCCTCCTCGG - Intronic
1180084981 21:45504467-45504489 CCCGGGGGCGGCGGTTTCTTCGG + Exonic
1180599555 22:17007437-17007459 CGAGGTGCCCGCGTTTTCCTGGG + Intronic
1183311679 22:37113209-37113231 CCCGGAGGCTTCTTTTTCCTTGG - Intergenic
1185208508 22:49553754-49553776 CCCGGATGCTGCGTGTTCCTAGG - Intronic
954384319 3:50236355-50236377 CTCGGCCGCCGCCTTGTCCTCGG - Exonic
954685615 3:52368654-52368676 CCCGGCGGCCAGGCTTCCCTGGG + Intronic
961779895 3:129315324-129315346 CCCGGCGGCCGCCGTCTTCTTGG + Exonic
963038346 3:141051288-141051310 CCCGGCGACCGCGCCTTCCGCGG + Intergenic
969714408 4:8861345-8861367 CCCGGAGGCCGCGCTTCCCGCGG + Intronic
975064452 4:70043020-70043042 CCCAGGGGCAGCGTTTGCCTGGG + Intergenic
987193317 5:15500585-15500607 CCCGTCGGGCGGGCTTTCCTCGG + Exonic
988796322 5:34656390-34656412 CCCGGCGGCCGCGTTTTCCTGGG + Intronic
997485228 5:134225691-134225713 CCTCACGGCCGCCTTTTCCTCGG + Intronic
1001563308 5:172684009-172684031 CCCGGCGGCGACGTGCTCCTGGG + Exonic
1002313972 5:178331542-178331564 CCCGAGGGCCGCGGATTCCTTGG - Intronic
1019278261 7:187380-187402 CACGGCGGCCTCTTTCTCCTGGG + Intergenic
1035435550 7:158856699-158856721 CCGGGCGGCCGCGGTGTCCTCGG - Exonic
1037865811 8:22441334-22441356 CGCGGCCGCCGCCTTCTCCTCGG - Exonic
1038266752 8:26044178-26044200 CCCGGCCGCCTCGTCTTCCCGGG + Intronic
1046770495 8:118112158-118112180 CCCGGCCGCCGCGTTTCCGCAGG - Intergenic
1048919327 8:139213520-139213542 CCCCGCGGCCGCCTCTTCCTGGG - Intergenic
1057128490 9:92637650-92637672 CCCGGGGGACAGGTTTTCCTTGG - Intronic
1061218733 9:129236766-129236788 CCCGGCTGCCCCGTGTTCCCAGG - Intergenic
1198424109 X:136497518-136497540 CCGAGCGGCCGCGATTTCCCGGG + Intronic