ID: 988796322

View in Genome Browser
Species Human (GRCh38)
Location 5:34656390-34656412
Sequence CCCGGCGGCCGCGTTTTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 47}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988796318_988796322 -7 Left 988796318 5:34656374-34656396 CCGAGCAGGAAGCGAGCCCGGCG 0: 1
1: 0
2: 0
3: 7
4: 96
Right 988796322 5:34656390-34656412 CCCGGCGGCCGCGTTTTCCTGGG 0: 1
1: 0
2: 0
3: 6
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988796322 Original CRISPR CCCGGCGGCCGCGTTTTCCT GGG Intronic