ID: 988796605

View in Genome Browser
Species Human (GRCh38)
Location 5:34657358-34657380
Sequence TGAGCCCCCTCCACAAAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 135}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988796605_988796611 1 Left 988796605 5:34657358-34657380 CCCCCTTTTGTGGAGGGGGCTCA 0: 1
1: 0
2: 0
3: 15
4: 135
Right 988796611 5:34657382-34657404 AGCCTGGAGAAGCAACAGACGGG No data
988796605_988796614 10 Left 988796605 5:34657358-34657380 CCCCCTTTTGTGGAGGGGGCTCA 0: 1
1: 0
2: 0
3: 15
4: 135
Right 988796614 5:34657391-34657413 AAGCAACAGACGGGGAATTAAGG 0: 1
1: 0
2: 0
3: 12
4: 91
988796605_988796610 0 Left 988796605 5:34657358-34657380 CCCCCTTTTGTGGAGGGGGCTCA 0: 1
1: 0
2: 0
3: 15
4: 135
Right 988796610 5:34657381-34657403 GAGCCTGGAGAAGCAACAGACGG 0: 1
1: 0
2: 2
3: 47
4: 392
988796605_988796612 2 Left 988796605 5:34657358-34657380 CCCCCTTTTGTGGAGGGGGCTCA 0: 1
1: 0
2: 0
3: 15
4: 135
Right 988796612 5:34657383-34657405 GCCTGGAGAAGCAACAGACGGGG 0: 1
1: 0
2: 1
3: 14
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988796605 Original CRISPR TGAGCCCCCTCCACAAAAGG GGG (reversed) Intronic
900480182 1:2894433-2894455 TGAGCCCCCTCTAGAAAAAAAGG - Intergenic
900837834 1:5019561-5019583 TTCGCCCCCTCCACAAAGTGAGG - Intergenic
901217630 1:7563508-7563530 TGGGCCCACTCCACATGAGGAGG - Intronic
901232642 1:7649768-7649790 GGGGCGCACTCCACAAAAGGGGG - Intronic
901621565 1:10592599-10592621 TTAGCTCCTTCCACATAAGGAGG - Intronic
903952520 1:27004590-27004612 GGAGGCCCCTCCAGTAAAGGTGG - Intergenic
904304397 1:29578215-29578237 TGTGCCCCCTCCCCAAACTGAGG - Intergenic
904757483 1:32776148-32776170 TGCCCCCCCTCCAAAAAAGGGGG - Intronic
908742573 1:67343538-67343560 TTAGGCCCCTTTACAAAAGGGGG + Intronic
912647375 1:111406666-111406688 TGATCCACCTGCACAAAAGGAGG + Intergenic
913101579 1:115572599-115572621 TGAGTCCCTCCCACAACAGGTGG - Intergenic
915902058 1:159854571-159854593 AGAGCCTCCTCCCCAAAAGTGGG - Exonic
919756047 1:201066778-201066800 TGGGCCCCTGCCACAAGAGGAGG - Intronic
920194691 1:204219003-204219025 TGAGCCCCCTCCCCAGGAGGAGG - Exonic
920695727 1:208180115-208180137 TGTTCCTCCTCCACAACAGGCGG + Intronic
921724516 1:218508884-218508906 TGAGTTCCCTCCCCAACAGGTGG + Intergenic
923095930 1:230775122-230775144 TGAGCCCCCACCAAGACAGGAGG - Intronic
1067221989 10:44350902-44350924 TGTGCTCCCTACAAAAAAGGGGG - Intergenic
1072709292 10:97705585-97705607 TGAGCCCCACCCACAATTGGAGG - Intergenic
1072752468 10:97992229-97992251 TCAACCCCCTCCAAATAAGGTGG - Intronic
1073242450 10:102067215-102067237 TGTGCCAGCTCCACAAAGGGTGG - Exonic
1073731759 10:106296410-106296432 TGAGCTCCTTCCCCAAAAGTAGG + Intergenic
1073765243 10:106675082-106675104 AGAACCCCATCCACAAAAAGTGG + Exonic
1075917512 10:126181860-126181882 TCAGCTCCCTCCACACCAGGAGG - Intronic
1076193691 10:128500070-128500092 TGAGGCCCCAGCAAAAAAGGGGG - Intergenic
1076557369 10:131336028-131336050 TGAGCCCTCTCCACCAGAGGAGG + Intergenic
1077766636 11:5165223-5165245 TTACCCCCCTCCAGAAAAGTGGG + Intronic
1077905641 11:6530732-6530754 TGAACCCCCTGTACAAGAGGAGG - Intronic
1080841448 11:35987124-35987146 TGACCCACCTCCACCACAGGAGG - Intronic
1080991716 11:37545191-37545213 TGAGTCCCTTCCACAACAAGTGG + Intergenic
1083777370 11:64900777-64900799 TGAGCCCCATCCACCCCAGGTGG - Intronic
1084115663 11:67041662-67041684 GTAGCCCTCTCCACACAAGGTGG - Intronic
1084412578 11:69013108-69013130 GAAGAGCCCTCCACAAAAGGAGG - Exonic
1085754883 11:79193996-79194018 TGAGTCCCTCCCACAACAGGTGG - Intronic
1085995566 11:81908701-81908723 TGAGTCCCTTCCACAACACGTGG - Intergenic
1089001544 11:115055984-115056006 AGGGCACCCTCCAAAAAAGGTGG - Intergenic
1090643424 11:128748264-128748286 TGAGCCCCCTCCCCAGGAAGTGG + Intronic
1091791294 12:3273663-3273685 TGGGCTCCCTCCACCAGAGGCGG + Intronic
1101745558 12:107538811-107538833 TGAGCCCCCACCCCACAAAGTGG + Intronic
1104272465 12:127294336-127294358 TGAGCCTCCACGACATAAGGAGG + Intergenic
1109152223 13:58859556-58859578 TGAGCCCACCCCACGGAAGGAGG - Intergenic
1115010455 14:28539220-28539242 TGGGTCCCTTCCACAAAATGTGG - Intergenic
1117834396 14:59787260-59787282 TGAGCCCCCACCGCAGCAGGAGG - Intronic
1119098381 14:71855661-71855683 TGAGCTCCCTCCACTGAAGAAGG + Intergenic
1120385564 14:83841262-83841284 TGAGCCCCCCCCCCAAAAGCAGG + Intergenic
1120541217 14:85753283-85753305 TGGGTCCTCTCCACAACAGGTGG + Intergenic
1120553261 14:85897516-85897538 TCAGTCTCCTCCATAAAAGGTGG + Intergenic
1121125789 14:91405988-91406010 AGAGCTCCCAGCACAAAAGGAGG + Intronic
1122854567 14:104554029-104554051 TGAGCTCCTTCCTCAAAAGGTGG - Intronic
1126854246 15:52822657-52822679 TGAGCCACTTGAACAAAAGGTGG + Intergenic
1129335037 15:74846859-74846881 TGATCCTCCTTCACAGAAGGTGG - Intronic
1132426312 15:101720729-101720751 TGGGTCCCTTCCACAAAACGTGG - Intronic
1132725438 16:1336347-1336369 TGAGCCTCCCCCCCAAAAGATGG - Intronic
1134128004 16:11629640-11629662 TGAGCTCCTTCCCCAAAAGCAGG - Intronic
1136497475 16:30653013-30653035 GGAGGGCCCTTCACAAAAGGTGG + Exonic
1137760627 16:50937312-50937334 TGGGGCCCTTCCACAACAGGTGG - Intergenic
1138142185 16:54578374-54578396 TGAGGCCTCTTAACAAAAGGTGG + Intergenic
1139770978 16:69276309-69276331 TCTGGCCTCTCCACAAAAGGGGG + Intronic
1142605115 17:1077244-1077266 TGAGCCCCCTCCTCACGAGCTGG + Intronic
1148192263 17:45687885-45687907 TGAGCTCCATCCCCAAAAAGAGG - Intergenic
1148816263 17:50330127-50330149 TCAGACCCTTCCACAATAGGAGG + Intergenic
1148980827 17:51573115-51573137 TAATCCCTCTCCACAAAAGGAGG - Intergenic
1156399691 18:36729122-36729144 TGAGCTCCCTCAACAACAGAGGG + Intronic
1159984013 18:74820438-74820460 TGAGAGCCATCCACAATAGGTGG - Intronic
1162541773 19:11301009-11301031 TGTGCCCCCACCACAAGAGAGGG - Intronic
1164013236 19:21228083-21228105 AGAACCCCCCCCTCAAAAGGTGG + Intronic
1166722866 19:45007448-45007470 TGAGCTTCCTCTACAAAATGAGG - Intronic
1167101051 19:47404509-47404531 CCAGCCCCCTACACACAAGGAGG - Intronic
925781840 2:7388685-7388707 TGAGTCCCTTCCACAACATGTGG + Intergenic
927228396 2:20794280-20794302 TGAGCCCCTCCCACAACACGTGG + Intronic
928924602 2:36565034-36565056 TGTGCCCCTTCCCCAAAGGGAGG - Intronic
929302322 2:40319867-40319889 TAAGCTCTCTCCACAGAAGGAGG - Intronic
932531696 2:72541052-72541074 TGGGTCCCTCCCACAAAAGGTGG - Intronic
932629725 2:73329428-73329450 TGAGCCCCTTCCATAAAACGTGG - Intergenic
935216648 2:100980243-100980265 TGAGCCGCCTCCACTGCAGGTGG + Intronic
936247145 2:110838022-110838044 GGAGCCCCTTAGACAAAAGGAGG - Intronic
939037564 2:137150376-137150398 TGAGCCCCTCCCACAACATGTGG - Intronic
942821928 2:180124789-180124811 TTAGCCCCCTCCAGCCAAGGAGG - Intergenic
943003543 2:182360731-182360753 TGGGCCCCTTCCACCATAGGGGG - Intronic
943026594 2:182636936-182636958 TGAGCTCCCTCCAGCAATGGCGG + Intergenic
945754901 2:213833968-213833990 TGGGCCCCTTCCACAACACGTGG - Intronic
946705383 2:222453433-222453455 TGAGCCACCTCCACAACAACAGG + Intronic
948259139 2:236590111-236590133 TGGGACCCCTCAACATAAGGAGG + Intergenic
948897956 2:240935982-240936004 TGAGCTTCCTCAACAAAAGATGG - Intronic
1172310431 20:33913733-33913755 TGGGCCACCTCCAGAAAAGGTGG + Intergenic
1172855989 20:38002896-38002918 TGAGACACCTCCACTCAAGGGGG + Intronic
1174943845 20:54963066-54963088 TGAGCCTCCGAGACAAAAGGAGG + Intergenic
1175986162 20:62765105-62765127 TGAGCCCCCTCCACCAACAGTGG + Intergenic
1179448778 21:41453284-41453306 TGAGTCCCTCCCACAACAGGTGG + Intronic
1181391809 22:22588410-22588432 GGAGCCCCGGACACAAAAGGAGG - Intergenic
1182318375 22:29462854-29462876 TGAGCCCCATCCATAAAATAGGG - Intergenic
1183546341 22:38456189-38456211 TGTGCCCCCCCCCCAAAAGGGGG + Intergenic
1184181903 22:42834274-42834296 TTTGTCCCCTCCACCAAAGGAGG - Exonic
1184406771 22:44304875-44304897 TGAGCCCCAGCCACAGAAGTGGG - Intronic
1185383640 22:50521758-50521780 AGAGCCTCCTCCACACAGGGGGG - Exonic
950111831 3:10423622-10423644 GGAGGCCCCTCCCCAGAAGGAGG - Intronic
952246353 3:31597021-31597043 TTAGCCCTCTCCACCAAAGCAGG - Intronic
957981853 3:87520414-87520436 TGGGTCCCTTCCACAAAATGTGG - Intergenic
958028285 3:88074972-88074994 AGAGCACCCTCCACAAAATATGG - Intronic
958588022 3:96116959-96116981 TGAGTCCCTCCCACAAAATGTGG - Intergenic
958600207 3:96287821-96287843 TGAGCCCCTCCCACAACACGTGG - Intergenic
962348566 3:134640415-134640437 TGATAACCTTCCACAAAAGGTGG + Intronic
963708960 3:148724199-148724221 TGGCCCCCCTCCAAGAAAGGGGG + Intronic
964479857 3:157129798-157129820 TGAGCCTCCTTCTGAAAAGGTGG - Intergenic
967322631 3:188209679-188209701 TGAGCTTCATCCACAAAGGGTGG + Intronic
968627117 4:1630768-1630790 TGAGCCCCCTCCCCACGAGTGGG - Intronic
970891302 4:21047950-21047972 TAGGCCCCCTCCACATATGGGGG - Intronic
975125342 4:70776096-70776118 TGTATCCCCTCCACATAAGGGGG - Intronic
976125298 4:81828016-81828038 TGAGTCACCTCCACCAAAGTTGG + Intronic
984515203 4:180730456-180730478 TGGGTCCCTTCCACAAAATGTGG - Intergenic
984856516 4:184200400-184200422 GGAGGCCTCTCAACAAAAGGTGG + Intronic
986025392 5:3845818-3845840 TCTGCCTCCTCCACAAAAGGTGG + Intergenic
986323479 5:6653257-6653279 TGTCCCTCCTCTACAAAAGGAGG + Intronic
988796605 5:34657358-34657380 TGAGCCCCCTCCACAAAAGGGGG - Intronic
992829322 5:80578923-80578945 ACAGCCCTCTCCACAAAAGAGGG + Intergenic
993575273 5:89591962-89591984 TGGGTCCCTTCCACAAAACGTGG - Intergenic
996973896 5:129407740-129407762 TGAGTCCCTTCCACAAAATGTGG - Intergenic
1001156354 5:169275759-169275781 TGGGTCCCTTCCACAACAGGTGG + Intronic
1001476388 5:172054082-172054104 TCAGCCCCGTCCCCACAAGGGGG + Intronic
1006629212 6:35419155-35419177 TGAGCAACCTCCCCAAAAGCAGG - Intronic
1007729445 6:43937053-43937075 TGTGGCCTTTCCACAAAAGGAGG - Intergenic
1012457600 6:99424878-99424900 TGAACCCCCTTCCCACAAGGGGG + Intronic
1015525985 6:134175590-134175612 TGCGGCCCCGCCACAAAAAGAGG - Intronic
1017204534 6:151790460-151790482 TGAACCCCTTCCACAACAGGTGG - Intronic
1019754011 7:2754735-2754757 TGAGACCCTGCCTCAAAAGGAGG + Intronic
1024294895 7:47833921-47833943 TGAGCACCCTCCTCACAAGGAGG + Intronic
1025937714 7:66050552-66050574 TCAGCCTCCTGCAGAAAAGGTGG - Intergenic
1028083904 7:86613827-86613849 TGAGTCCCTTCCACAACACGTGG - Intergenic
1032025149 7:128435321-128435343 TGGGGCCCATCAACAAAAGGGGG + Intergenic
1032728324 7:134613039-134613061 TGGGCCCCTTCCACAACATGTGG + Intergenic
1034963900 7:155379670-155379692 TCAGCCCTCTGCCCAAAAGGGGG + Intergenic
1040975967 8:53194906-53194928 TGACCCCCCTCCACAAGGTGTGG + Intergenic
1042639313 8:70915812-70915834 CAAGTCTCCTCCACAAAAGGCGG - Intergenic
1045093257 8:98769289-98769311 TGAGTCCCTACCACAACAGGTGG - Intronic
1047035190 8:120930476-120930498 AGATCGCCCTCAACAAAAGGAGG + Intergenic
1049298186 8:141854974-141854996 TCAGCTCCTGCCACAAAAGGTGG + Intergenic
1049319958 8:141991039-141991061 TGACCCGTCTCCACCAAAGGGGG + Intergenic
1050523669 9:6527410-6527432 TGACCCGCATCCATAAAAGGTGG + Intergenic
1059255244 9:112924406-112924428 TTGTCCCCCTCCCCAAAAGGAGG - Intergenic
1059416241 9:114164158-114164180 TGAGCCCCCTCTATAAAGTGAGG + Intronic
1061941225 9:133885205-133885227 TGAGCCCACTCAACCAAGGGCGG + Intronic
1062523231 9:136968248-136968270 TGAGCCCCCTGCACACCAGCCGG + Intergenic
1188912520 X:35866850-35866872 TGAGCCCCTCCCACAACACGTGG - Intergenic
1189348660 X:40261239-40261261 GTGGCCCCCTCCACAAAATGGGG - Intergenic
1191105725 X:56770907-56770929 AGAGCCCCCCCCCCAAAAAGAGG - Intergenic
1191106718 X:56776309-56776331 AGAGCCCCCCCCCCAAAAAGAGG - Intergenic
1191742100 X:64447167-64447189 TGAACACCCTCCACAAAAACAGG + Intergenic
1191873850 X:65773772-65773794 TGAGTCACCTCCACAATAGCAGG + Intergenic
1196055529 X:111351043-111351065 TGAGTCCCTTCCACAACATGTGG + Intronic
1196545374 X:116958378-116958400 TGAGTCCCTCCCACAACAGGTGG - Intergenic
1197054403 X:122098756-122098778 AGAGCCCCTTCCACAACATGTGG - Intergenic