ID: 988800686

View in Genome Browser
Species Human (GRCh38)
Location 5:34693722-34693744
Sequence CTGTTAGCAAGCGTGTGCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 88}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988800686 Original CRISPR CTGTTAGCAAGCGTGTGCTG CGG (reversed) Intronic
901022809 1:6263539-6263561 CTGTGAGCACGTGTGTGGTGAGG - Intergenic
901023563 1:6267367-6267389 CTGTTACCATGGGTGTCCTGGGG + Intronic
908943070 1:69459831-69459853 CTGTTAGGCAGCATTTGCTGTGG + Intergenic
910198130 1:84667428-84667450 CTGTTAGCGACCCTTTGCTGAGG - Intronic
912681576 1:111732448-111732470 CTGAGAGCAAGCTTGTTCTGAGG - Intronic
913230181 1:116735090-116735112 CTCTGACCAAGCGAGTGCTGTGG + Intergenic
920724283 1:208419336-208419358 CTCTTTGCAAACGTTTGCTGAGG - Intergenic
921738945 1:218661408-218661430 CTGTTGGCAAATGTCTGCTGGGG - Intergenic
1063176940 10:3559441-3559463 ATGTTAACAAGTGTGTGATGTGG + Intergenic
1070835272 10:79444030-79444052 ATGTACGCAAGGGTGTGCTGGGG - Intronic
1072151699 10:92689745-92689767 CTGGTAGCAAGCGCGTCCCGGGG + Intergenic
1072747392 10:97950519-97950541 CTGTAAGCCAGCGTGGTCTGAGG + Intronic
1076680360 10:132168517-132168539 CTGTTGGCCAGCGGGTGCTCAGG - Exonic
1077316294 11:1920826-1920848 CTGGTGGCAGGGGTGTGCTGGGG - Intronic
1077480118 11:2810528-2810550 CAGAGAGCAAGCGTGTGCTCTGG - Intronic
1078024053 11:7677984-7678006 CTCTCAACAAGCGTTTGCTGAGG + Intergenic
1079800223 11:24859892-24859914 CTGTAAGACAGCGTGTTCTGGGG - Intronic
1080852174 11:36079118-36079140 CAGTAAGGAAGCGTGAGCTGTGG - Intronic
1096324141 12:50643285-50643307 GTATTAGAAAGCGTATGCTGTGG + Intronic
1102187206 12:110958028-110958050 CTGACAGCCATCGTGTGCTGCGG + Intergenic
1103763406 12:123266589-123266611 CTGTTCGCCAGCCTGGGCTGGGG + Intronic
1104978943 12:132564377-132564399 GTGATAGGAAACGTGTGCTGTGG + Intronic
1113292628 13:108923263-108923285 CTGTTTTCAACCGTGTTCTGAGG - Intronic
1114182603 14:20378767-20378789 CTGCTAGCCACCGTGTGCTTGGG - Exonic
1118365939 14:65096138-65096160 CTGGTAGAAAGCCTGGGCTGGGG + Intronic
1121571577 14:94950530-94950552 CTGTTATGAAGCGTCTGCTGTGG - Intergenic
1122694150 14:103544671-103544693 CTGTGAGCACATGTGTGCTGCGG - Intergenic
1122817926 14:104322957-104322979 ATGCTCGCATGCGTGTGCTGTGG + Intergenic
1125629033 15:41132505-41132527 CTGTTATCAAGTTTGTACTGGGG - Intergenic
1127742488 15:61925190-61925212 CTATTTGCATGCGTGTGTTGTGG - Intronic
1130325192 15:82873955-82873977 CAGTTAGCAGGCCTCTGCTGTGG + Intronic
1131119251 15:89812961-89812983 TTGTTAGCCAGGGAGTGCTGGGG + Intronic
1134599376 16:15521466-15521488 CTGTTAGTAAGCATTTGATGTGG - Intronic
1135201551 16:20441946-20441968 CTGTTTGCAGGCCTGAGCTGTGG - Intergenic
1135217557 16:20585920-20585942 CTGTTTGCAGGCCTGAGCTGTGG + Intergenic
1136266986 16:29127702-29127724 CAGGTAGCAACCGTGTGCCGGGG + Intergenic
1138290913 16:55846085-55846107 CTGATAGAAAGTGGGTGCTGGGG + Intergenic
1144279264 17:13708426-13708448 CTGTTTGTAAGTGTGTGCTAAGG - Intergenic
1144841551 17:18189547-18189569 CTGGTAGCAAGCCTGTCCAGGGG - Intronic
1144879096 17:18421793-18421815 CTTTTTGCATGCCTGTGCTGTGG + Intergenic
1145153138 17:20522594-20522616 CTTTTTGCATGCCTGTGCTGTGG - Intergenic
1147127096 17:38378561-38378583 CTGTTAGGAAGTATCTGCTGTGG + Intronic
1153199536 18:2634443-2634465 CAGTAAGCAAGCGTGTGGTGTGG + Intergenic
1153416796 18:4854753-4854775 CAGTTGGCAAAAGTGTGCTGTGG + Intergenic
1153885590 18:9462131-9462153 CTGTTAGCATGCATGAACTGTGG - Intergenic
1161557629 19:4953275-4953297 CTGGTTTCAAGCATGTGCTGAGG - Intronic
1165003052 19:32780676-32780698 CTGTGAGCAGGTGAGTGCTGCGG + Intronic
1166753665 19:45177854-45177876 CTGTTATTGGGCGTGTGCTGAGG - Intronic
1166770158 19:45276966-45276988 CTGGTAGCAAGCATGTGAAGTGG + Intronic
929543252 2:42838476-42838498 CTGTTAGAAAGCTTGCTCTGGGG + Intergenic
942453354 2:176122217-176122239 CTGTGAGCAAGCGTGTGTGTGGG + Intergenic
1172371136 20:34393071-34393093 CTGTTAGCATGCATGAGTTGGGG - Intronic
1172645576 20:36467213-36467235 CTGTAATTAAGCGTCTGCTGAGG + Intronic
1175720462 20:61283379-61283401 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720463 20:61283418-61283440 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720464 20:61283457-61283479 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1178511014 21:33205061-33205083 GTGTGAGCTAGCGTGGGCTGGGG - Intergenic
1181099790 22:20531539-20531561 CTGGGAGAAGGCGTGTGCTGGGG - Intronic
1181415676 22:22757013-22757035 CTGTTGACAAGGGTGGGCTGTGG - Intronic
954153428 3:48671289-48671311 CTGGTAGCAAGCGTGCTCTGAGG - Intergenic
958981911 3:100731062-100731084 CTGCCAGCCAGTGTGTGCTGTGG + Intronic
962843323 3:139254567-139254589 CTCTAAGCAAGGGTGTGATGTGG - Intronic
969624208 4:8294155-8294177 CTGTGAGGAACCGTGTGATGCGG - Exonic
978042246 4:104081992-104082014 CTTTTAGAAAACGTGTACTGAGG - Intergenic
988800686 5:34693722-34693744 CTGTTAGCAAGCGTGTGCTGCGG - Intronic
996845527 5:127895047-127895069 ACGTAAGTAAGCGTGTGCTGCGG + Intergenic
997626480 5:135334609-135334631 CCGTTTGTAAGCGTGTGTTGTGG - Exonic
997802819 5:136883864-136883886 CTGTTTACAGGCGTGTGCAGAGG + Intergenic
999250004 5:150176884-150176906 CTGTTTGCATGTGTGTGTTGGGG + Intronic
999822446 5:155241369-155241391 CTGTTAGCCAGCCAGTGCAGGGG + Intergenic
1002640473 5:180628341-180628363 CGATCTGCAAGCGTGTGCTGCGG - Intronic
1003038342 6:2664455-2664477 CAGTGTGCATGCGTGTGCTGGGG - Exonic
1003286660 6:4740223-4740245 CTGTTAGCACACGTGGGATGAGG - Intronic
1003756702 6:9128909-9128931 CTGGTACCAAGCATGTGTTGAGG + Intergenic
1006557037 6:34876051-34876073 CTGTTTACATGCATGTGCTGGGG + Exonic
1013573673 6:111456313-111456335 CTGTTCTCAAGTATGTGCTGGGG + Intronic
1014254645 6:119148574-119148596 CTGGCAGCAATAGTGTGCTGGGG - Intronic
1021018460 7:15565438-15565460 GTGTTAGCAAGAGTGTGGAGGGG - Intergenic
1023762919 7:43483509-43483531 CTGTTAGGAAACCTGAGCTGTGG - Intronic
1024043479 7:45572876-45572898 CTGTCATCAAGTGTCTGCTGGGG + Intergenic
1024530259 7:50385458-50385480 CTGACAGCAAGAGGGTGCTGGGG + Intronic
1026550061 7:71360643-71360665 CTGATAGCCAGCGGGTGCAGTGG + Intronic
1035187955 7:157140309-157140331 CTGTTATTAAGATTGTGCTGTGG + Intronic
1035680513 8:1484095-1484117 CTGGGAGCCAGCGTGGGCTGAGG + Intergenic
1044845393 8:96375270-96375292 CATTTAGCAAGAGGGTGCTGGGG + Intergenic
1047684923 8:127295238-127295260 GTGTTTGCAAGCATGGGCTGCGG + Intergenic
1055263043 9:74461306-74461328 CTATTAGTAAGCATGTCCTGTGG + Intergenic
1058712623 9:107693985-107694007 CTGGTGGGAAGCATGTGCTGTGG + Intergenic
1060072433 9:120562035-120562057 CTTTTGACAAGCGTGTGTTGAGG - Intronic
1195403566 X:104488239-104488261 TAGTTAGTAAGCCTGTGCTGGGG + Intergenic
1198530764 X:137548382-137548404 CTGTGCGCAGGGGTGTGCTGAGG + Intergenic
1198947680 X:142032275-142032297 CTGTCAGCAACCATGTGGTGTGG - Intergenic