ID: 988801893

View in Genome Browser
Species Human (GRCh38)
Location 5:34703727-34703749
Sequence TTTAAGCTTTAGTTGCTTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 539
Summary {0: 1, 1: 0, 2: 4, 3: 48, 4: 486}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988801890_988801893 -3 Left 988801890 5:34703707-34703729 CCTTGCAAGGGGCCCTGAGGTTT 0: 1
1: 0
2: 1
3: 19
4: 146
Right 988801893 5:34703727-34703749 TTTAAGCTTTAGTTGCTTTATGG 0: 1
1: 0
2: 4
3: 48
4: 486

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988801893 Original CRISPR TTTAAGCTTTAGTTGCTTTA TGG Intronic
902427347 1:16334860-16334882 TTTAATTTGTATTTGCTTTAAGG - Intronic
904772916 1:32890907-32890929 TTGACTCTTTAGTTGCTTGATGG + Intronic
906903335 1:49861845-49861867 TCTAAGCTGTATCTGCTTTAGGG - Intronic
909420775 1:75462340-75462362 TCTAAGCTGTATTTGTTTTAGGG - Intronic
910156184 1:84223147-84223169 TTGAATATTTCGTTGCTTTAAGG + Intronic
910553986 1:88509253-88509275 TTTAAGCTTTAGTACTTTTTTGG - Intergenic
910835731 1:91507453-91507475 TTTAAGATTTTGTATCTTTACGG + Intronic
911046956 1:93636717-93636739 TTTAAGCTGTAGTTTTTTAAGGG - Intronic
911536555 1:99106740-99106762 TCTAAGCTGTATCTGCTTTAGGG - Intergenic
911689662 1:100818780-100818802 TATTAGCTTTAGTAGCTTTTTGG + Intergenic
911758263 1:101585822-101585844 TTTCACCTTTAGTTCCTCTAGGG + Intergenic
912598677 1:110904595-110904617 TCTAAGCTGTATCTGCTTTAGGG - Intergenic
913364363 1:118019733-118019755 TTTAAGTTGTTGTTGCTTTGAGG - Intronic
915790795 1:158668783-158668805 TTTTTGCTTTAGTTTGTTTATGG - Intronic
915856972 1:159398205-159398227 TTTAAGCTGTTTCTGCTTTAGGG - Intergenic
916185115 1:162124132-162124154 TTTAAATTTCAGTAGCTTTAGGG + Intronic
916909352 1:169328847-169328869 TCTAAGCTATATCTGCTTTAAGG - Intronic
917814194 1:178691029-178691051 TTCAAGCTTTAAGTGCTTTTGGG - Intergenic
917978963 1:180257711-180257733 TTTATGCTTTAATTGCTTGGCGG - Intronic
918268516 1:182871783-182871805 TTTAAATTTTACTTACTTTATGG - Intronic
918338675 1:183548352-183548374 TTTATGCTAGAGTGGCTTTAAGG + Intronic
918988803 1:191670004-191670026 TTTAAGCTTTGGCTGTTTTATGG - Intergenic
919278679 1:195456151-195456173 TTAAATATTTGGTTGCTTTATGG + Intergenic
920754264 1:208713704-208713726 TTTTAGCATTATTTGCTATATGG + Intergenic
921042731 1:211449065-211449087 TCTAAGCTGTATCTGCTTTAGGG - Intergenic
921273826 1:213497340-213497362 TTTAACTTTTTATTGCTTTATGG - Intergenic
923970411 1:239196181-239196203 TTTAGGCTTTAGTTACTAGATGG - Intergenic
924005205 1:239601379-239601401 TTTAAGCTGTATTTTCTTAAAGG + Intronic
924072171 1:240292001-240292023 TATAAGTTTCAGTTCCTTTATGG - Intronic
924328493 1:242919809-242919831 TTTAAACTTTAATTACTTTAAGG - Intergenic
1063803122 10:9604201-9604223 ATTAAACTTTAATTCCTTTAGGG + Intergenic
1063937707 10:11096150-11096172 TTTAAGCTTTAGTTGTTCAGAGG - Intronic
1064819030 10:19303025-19303047 TTTAATCTTTTGTTACTTTAGGG - Intronic
1066084629 10:31964043-31964065 TCTAAGCTGTATCTGCTTTAGGG - Intergenic
1066348447 10:34613014-34613036 TTGTAGCTTTGGTTGATTTATGG - Intronic
1067154390 10:43764872-43764894 TTAAAACTTCAGTAGCTTTAGGG + Intergenic
1067906450 10:50295931-50295953 TTGAATCTTCGGTTGCTTTATGG - Intergenic
1068020283 10:51573570-51573592 TTTAAGGTTTATTAGCTTCATGG - Intronic
1068236046 10:54233633-54233655 TTTTAGGTCTAGCTGCTTTATGG + Intronic
1068268279 10:54683226-54683248 TTTACAGTTTAGTGGCTTTAAGG + Intronic
1068321244 10:55419736-55419758 TATTATCTATAGTTGCTTTAGGG + Intronic
1069147940 10:64918440-64918462 TCTAAGCTATATCTGCTTTAAGG - Intergenic
1069229726 10:65994788-65994810 TTGAAACTTTGGTTACTTTATGG + Intronic
1069933431 10:71899259-71899281 TCTAAGCTGTATCTGCTTTAGGG + Intergenic
1070076217 10:73139028-73139050 TTTACTCTTTAGTAGCTTTATGG - Intronic
1070406338 10:76100729-76100751 TTAAAGCTTTTGTTCTTTTAAGG + Intronic
1071018202 10:81022192-81022214 TCTAAGCTGTATCTGCTTTAGGG - Intergenic
1071050991 10:81449245-81449267 TTTAAGCTATATCTGCTTTAAGG + Intergenic
1071786930 10:88911646-88911668 TTTGTGTTTTATTTGCTTTAGGG + Intronic
1071980012 10:90995999-90996021 TTTAACCATTCGTTGCTTGATGG - Intergenic
1072396756 10:95050721-95050743 TCTAAGCTGTATCTGCTTTAGGG - Intronic
1073507728 10:104015374-104015396 TTTAGGAGTTAGCTGCTTTAAGG + Intronic
1073544269 10:104335750-104335772 TTTAAGCTTAAGTTGCTTCTTGG + Intronic
1073678962 10:105680767-105680789 TCTAAGCTATATCTGCTTTAGGG - Intergenic
1073724102 10:106209930-106209952 TTTAGGCTTTAGCTACTTTCTGG - Intergenic
1074439574 10:113464415-113464437 TTTAAGCTTTTGTTGGAGTAGGG - Intergenic
1075273505 10:121073955-121073977 TTTAAGCTTCATTTGCTTGTAGG - Intergenic
1076086394 10:127635934-127635956 TTGAATATTTGGTTGCTTTATGG + Intergenic
1077381514 11:2242744-2242766 TTTCTGCTTTATTTGTTTTAAGG - Intergenic
1078691013 11:13580333-13580355 TCTAAGCTGTATCTGCTTTAGGG - Intergenic
1078816829 11:14832519-14832541 TTTAATTTTCAGTGGCTTTAGGG + Intronic
1079038077 11:17037731-17037753 TCCAAGCTGTATTTGCTTTAGGG - Intergenic
1079256132 11:18832617-18832639 TTTATTGTGTAGTTGCTTTATGG + Intergenic
1079701591 11:23555466-23555488 TCTAAGCTGTAACTGCTTTAGGG + Intergenic
1079927815 11:26517438-26517460 TTTAATCTTTACTTGCCTAAAGG - Intronic
1079961287 11:26927491-26927513 TTTAAGCTATATCTGCTTTAGGG + Intergenic
1080118916 11:28652593-28652615 TTTATGCTTAAATTGATTTAAGG + Intergenic
1080170902 11:29301400-29301422 TTTAAGCTTGTATTGCTTTTGGG + Intergenic
1082730125 11:56785782-56785804 TTTAAGCTTTAGCTCATTAAAGG - Intergenic
1082907778 11:58330181-58330203 CTTGACTTTTAGTTGCTTTATGG + Intergenic
1086602115 11:88646032-88646054 TTTAAGTTTGAGATGCTTTTAGG + Intronic
1087877079 11:103370777-103370799 TCTAAGCTCTACCTGCTTTAGGG - Intronic
1088361885 11:109000401-109000423 TTTAAGCTGTATTTGCTTTAGGG + Intergenic
1089937212 11:122376424-122376446 TCTAAGCTGTATGTGCTTTAGGG - Intergenic
1091927232 12:4363317-4363339 TTTTAGCTTTAGTTGAGTTCTGG + Intergenic
1091967058 12:4753872-4753894 TCTAAGCTGTACCTGCTTTAGGG + Intronic
1092062518 12:5563075-5563097 TTCAAGCTTAAGTTTCTTTTAGG - Exonic
1092283986 12:7118223-7118245 GATAAGCTTTAGTTTCATTAAGG + Intergenic
1092326648 12:7538684-7538706 TCTAAGCTGTATTTGCTTTAGGG + Intergenic
1092756958 12:11772775-11772797 TTTAGGCTTTTGTTGATTGAAGG - Intronic
1092921471 12:13235260-13235282 TATGAGCTTTAGTTTCCTTAGGG + Intergenic
1093977953 12:25443762-25443784 TTTAAATTTCAGTAGCTTTAGGG + Intronic
1094278125 12:28702360-28702382 TTTAAGTTTTAGTTTCATTTTGG + Intergenic
1094647470 12:32339743-32339765 TTTAAGCTTACTTTGGTTTATGG - Intronic
1095187995 12:39224307-39224329 TGTAAATTTTAGTTTCTTTAGGG + Intergenic
1095212663 12:39511215-39511237 TCTAAGCTGTATCTGCTTTAGGG - Intergenic
1095752159 12:45725515-45725537 TTTAAGGTTTAGTTGAATGAGGG + Intergenic
1095819141 12:46458260-46458282 TTTAATCTTCAGTTATTTTAAGG - Intergenic
1096028277 12:48387202-48387224 GTTAAGCTTAAGTTGCTGGATGG + Intergenic
1098369451 12:69740612-69740634 TTTAATGTTTAGCTGCTTTGTGG + Intronic
1098394994 12:70007630-70007652 TTGAATATTTGGTTGCTTTATGG - Intergenic
1098430927 12:70419139-70419161 TTTAAGAATTAATTCCTTTAAGG + Intronic
1099026814 12:77474903-77474925 TTTAAGCTTCAGTAGCTTCATGG - Intergenic
1100555433 12:95688510-95688532 ATTAAGCTTGAGATGCTTAAAGG + Intronic
1101076339 12:101133381-101133403 TCTAAGATATAGTTGCTTCATGG + Intergenic
1102795608 12:115686787-115686809 CTTAAGCTTCATTAGCTTTAAGG + Intergenic
1104103011 12:125633610-125633632 TCTAAGCTGTATCTGCTTTAGGG + Intronic
1107128104 13:36866076-36866098 TTTGAGCTGTGCTTGCTTTAGGG - Intronic
1107361401 13:39621320-39621342 TTTTAACTGTTGTTGCTTTAAGG - Intergenic
1107552071 13:41486774-41486796 TCTAAGCTGTATCTGCTTTAGGG + Intergenic
1107709061 13:43134610-43134632 ATTAATCTTTAGTTTCTATAGGG + Intergenic
1108020830 13:46126292-46126314 TTTAGCCTTCAGTTGGTTTAGGG + Exonic
1108115996 13:47128877-47128899 TTCAAGCTTTATGTGTTTTAAGG - Intergenic
1108255817 13:48610553-48610575 TTTAAGCTGTATCTGCATTAGGG + Intergenic
1109148743 13:58816860-58816882 TTAAAGCTTAAGTTTCTTTCTGG - Intergenic
1109275899 13:60304166-60304188 TTTAAGCTGCAGTGGCTTTGAGG + Intergenic
1109808003 13:67469681-67469703 TTGAACGTTTGGTTGCTTTATGG + Intergenic
1110011305 13:70337625-70337647 TTTCAGCTTCAATTGTTTTATGG - Intergenic
1110065020 13:71093322-71093344 TTTTAGTTTTAGTTTCTTTATGG + Intergenic
1110794766 13:79623425-79623447 TGTTAGCTTTAGTTTCTATAGGG - Intergenic
1111770583 13:92591005-92591027 TTTTAGCATTAGTTGTCTTATGG - Intronic
1112259562 13:97865713-97865735 TTTTAGCTTTACATACTTTAAGG - Intergenic
1112477164 13:99741858-99741880 TTTAATGTTTAGTTTCCTTAGGG + Intronic
1112618742 13:101033851-101033873 TATAAGCTGTATCTGCTTTAGGG + Intergenic
1113525396 13:110970888-110970910 TTTAACTTTTTGTTACTTTATGG - Intergenic
1114880551 14:26780246-26780268 TTTAATCTTCAGTTGCTATTTGG + Intergenic
1114906597 14:27135752-27135774 TTTAAGTTTCAATAGCTTTAGGG - Intergenic
1114955268 14:27809648-27809670 TTTCAGCTCTGGTTGATTTATGG - Intergenic
1114971029 14:28028859-28028881 TTTAATCTTGAGTGCCTTTAAGG - Intergenic
1115291296 14:31775845-31775867 CTTAAGCTTTATTAGCTTCATGG - Intronic
1116058006 14:39886822-39886844 TCTAAGCTGTATCTGCTTTAGGG - Intergenic
1116407193 14:44580158-44580180 TCTAAGCTGTATCTGCTTTAGGG - Intergenic
1116931191 14:50692843-50692865 TTGAATATTTGGTTGCTTTATGG + Intergenic
1117134961 14:52726194-52726216 TTTAAACATTAGTTGTGTTATGG - Intronic
1117159247 14:52972847-52972869 TCTAAGCTGTATCTGCTTTAGGG + Intergenic
1117264786 14:54075987-54076009 TCTAAGCTATATCTGCTTTAGGG + Intergenic
1119865469 14:77969745-77969767 TTGAAGCTTGTGTTGGTTTATGG - Intergenic
1120296695 14:82650431-82650453 TTTAAGCTTCATTAGCTTCATGG - Intergenic
1120674883 14:87409251-87409273 CTTAAGCCTTAGTAGCTTCAAGG - Intergenic
1120740544 14:88104765-88104787 TTGAATCTTTGTTTGCTTTATGG + Intergenic
1120808287 14:88776073-88776095 TCTAAGCTGTATCTGCTTTAGGG - Intronic
1121215054 14:92241376-92241398 TTTAAGCTATAGTTAATTTTAGG + Intergenic
1122328219 14:100895431-100895453 TTTATGTTTTATTTCCTTTAAGG - Intergenic
1122501259 14:102201726-102201748 TTTAAGGTTTATTTGCGTTTTGG + Intronic
1123858421 15:24437062-24437084 TTTATGTTGTAGTTGCTTTCAGG + Intergenic
1123863057 15:24487526-24487548 TTTATGTTGTAGTTGCTTTCGGG + Intergenic
1124081248 15:26500491-26500513 TCTAAGCTGTATCTGCTTTAGGG + Intergenic
1124606698 15:31174735-31174757 TTTGAGCTTCACTTGCTTCAGGG + Intergenic
1124844138 15:33274524-33274546 TCTAAGCTGTAGCTGTTTTAGGG + Intergenic
1126997228 15:54458656-54458678 TTTAAACTATTGTTCCTTTAAGG + Intronic
1127012574 15:54645653-54645675 TCTAAGCTGTATATGCTTTAGGG - Intergenic
1128480916 15:68037077-68037099 TTGAATATTTGGTTGCTTTATGG - Intergenic
1128806800 15:70537029-70537051 GTAAAGCTGTGGTTGCTTTAGGG + Intergenic
1131345732 15:91646632-91646654 GTAAAGCTTTATTTCCTTTAGGG + Intergenic
1132068806 15:98756996-98757018 ATTAAGTTTTAATTGCTTTGTGG + Intronic
1133971184 16:10569283-10569305 TTTAAGCTTAATGTGTTTTAAGG - Intronic
1135198888 16:20419481-20419503 TTTCATCTTTTGTTGCTTAAAGG - Intronic
1135652145 16:24215591-24215613 TTCAAACTTTATTTGCTTTGGGG + Exonic
1135936766 16:26787110-26787132 TTTTGGCTTAACTTGCTTTATGG - Intergenic
1136993567 16:35172534-35172556 CTAATGCTTTAGTTTCTTTATGG - Intergenic
1137398542 16:48134450-48134472 TATAACCTTTAGTTTCTATAGGG - Intronic
1137474581 16:48796503-48796525 TTTAAACTTAAGCAGCTTTATGG - Intergenic
1138040738 16:53662708-53662730 TTTAAGTTTTCGTTTCTTTGTGG - Intronic
1138166478 16:54806464-54806486 TTTAAGCTCTAATTGCTTCTAGG + Intergenic
1141642988 16:85352326-85352348 TTAAAGCTTTAGTTAGTTAATGG - Intergenic
1142921197 17:3188437-3188459 TTAAAGCATTATTTTCTTTATGG + Intergenic
1143993849 17:10990000-10990022 CTTAAGCTTCATTAGCTTTAAGG + Intergenic
1144251878 17:13425498-13425520 TTTTAGCTTGAGTCCCTTTAGGG - Intergenic
1144400955 17:14900752-14900774 GTTGAGCTTTTGTTGCTTAAAGG + Intergenic
1144885475 17:18455695-18455717 TTTATACTTCAGTTGGTTTATGG - Intergenic
1145146745 17:20488677-20488699 TTTATACTTCAGTTGGTTTATGG + Intergenic
1146762079 17:35487594-35487616 TTTAACTTTCAGTTGCTTAAGGG - Intronic
1146989993 17:37261128-37261150 TTTAAGGTTTAGTTGGTGTGTGG - Intronic
1147470497 17:40654515-40654537 ATGAAGCTTTATTTGCTTTGGGG - Intergenic
1148672872 17:49425239-49425261 TTTAATATTTGGTTGCCTTATGG + Intronic
1148975379 17:51523075-51523097 GTTATGCTTTATTTACTTTAAGG + Intergenic
1149851277 17:60036803-60036825 TTGAAAATGTAGTTGCTTTAGGG + Intergenic
1149880611 17:60286698-60286720 TGTTATCTTTAGTTGCTATAGGG - Intronic
1149906409 17:60529954-60529976 TCTAAGCTGTATCTGCTTTAGGG - Intergenic
1153416719 18:4853832-4853854 TTTAAGCTTTATTTTCTCAAAGG + Intergenic
1154283300 18:13027730-13027752 TTCAAGATTAAGTTGCTTTATGG + Intronic
1154386725 18:13898828-13898850 TCTAAGCCTTACCTGCTTTAGGG - Intronic
1155417278 18:25612727-25612749 TTTAAGCTTAAGTTTCCTTTGGG - Intergenic
1155443561 18:25885999-25886021 CTGAAGCTGTATTTGCTTTAGGG - Intergenic
1156135621 18:34033554-34033576 TTTAATATTTGATTGCTTTATGG - Intronic
1156279262 18:35618462-35618484 TTTATCTTTTAGTTGCATTATGG + Intronic
1157334999 18:46731627-46731649 CTTAAGATTGAGTTGTTTTAAGG - Intronic
1159896357 18:74000836-74000858 TCTAAGCTGTATCTGCTTTAAGG + Intergenic
1164388685 19:27798014-27798036 TTAACACTTTAGTTTCTTTATGG - Intergenic
1164600135 19:29556641-29556663 TATCAGCTTAAGTTGCTTTTTGG - Intronic
1165239360 19:34452280-34452302 TTTCAGCTCTAATTGCTGTATGG + Intronic
1165988141 19:39788558-39788580 TTGAAAATTTGGTTGCTTTATGG - Intergenic
1167025661 19:46915847-46915869 TTAAAACTTTAGGTTCTTTAAGG + Intergenic
1168439380 19:56350809-56350831 ATTAAACTTTATTTGATTTAAGG - Intronic
1168570492 19:57463763-57463785 TTTTTGCTTTAGTTTCTTTTGGG + Intronic
925637707 2:5957515-5957537 TTTTTGCTATTGTTGCTTTAAGG + Intergenic
926602167 2:14856252-14856274 TCTAAGCTGTATTTGCTTTAGGG - Intergenic
926636733 2:15188221-15188243 TTTTAGCTTTAGTTCCTTGTAGG - Intronic
929388521 2:41441527-41441549 TTTAAGCTGTTTTTGCTGTAGGG + Intergenic
929660928 2:43783893-43783915 TGTAAGCTTTAGTTGCTCAGGGG + Intronic
929775021 2:44924526-44924548 TTTATGCTTTAGTAGCTTTTTGG - Intergenic
929926428 2:46216268-46216290 TCTAAGCTGTATCTGCTTTAGGG + Intergenic
930159367 2:48138405-48138427 TCTAAGCTGTATCTGCTTTAGGG - Intergenic
930527637 2:52549475-52549497 TTTAAACTGTATCTGCTTTAGGG - Intergenic
930972231 2:57409443-57409465 TCTAAGCTGTATCTGCTTTAAGG - Intergenic
931161820 2:59701549-59701571 TCTAAGCTGTATCTGCTTTAGGG + Intergenic
931343734 2:61427006-61427028 TCTAAGCTGTATCTGCTTTAGGG - Intronic
931600717 2:64000571-64000593 TTTAAGCTGTATCTGCTTTAGGG + Intronic
931637401 2:64352742-64352764 TCTAAGCTGTATCTGCTTTAGGG - Intergenic
931672621 2:64662195-64662217 TTTGGGCTTTAGTTTCTTAAAGG - Intronic
932906402 2:75757414-75757436 TTTTAGTTTTGGTTCCTTTATGG + Intergenic
933227448 2:79767534-79767556 TCTAAGCTGTATCTGCTTTAGGG + Intronic
933608806 2:84412801-84412823 GTTAAGCTTGAGTGGCTTCATGG + Intergenic
933638912 2:84738903-84738925 TTTATTGTATAGTTGCTTTATGG + Intronic
933697516 2:85230911-85230933 TTTAGGCATTTGTTCCTTTATGG - Intronic
935497585 2:103800905-103800927 TATTAGTTTTAGTTGTTTTAAGG + Intergenic
936555395 2:113493014-113493036 GTTAAGCTTCTGTTTCTTTAGGG + Intronic
936962900 2:118095098-118095120 TTAAAGGTATAGTTGCTTTATGG - Intronic
937557874 2:123181261-123181283 TATAAGCTGTATCTGCTTTAGGG - Intergenic
937838616 2:126500236-126500258 TGTTAGCTCTAGTTGGTTTATGG - Intergenic
939483301 2:142777371-142777393 TCTAAGCTGTATCTGCTTTAGGG + Intergenic
939930628 2:148229694-148229716 TCTAAGCTGTATCTGCTTTAGGG + Intronic
940037288 2:149324144-149324166 TTTTACCTATAGTTGCTTAACGG + Intergenic
940315029 2:152319717-152319739 TTTAAGCTGTATCTGCTTTAGGG + Intergenic
940425524 2:153526505-153526527 TATAAGCTATATCTGCTTTAGGG - Intergenic
940684466 2:156828631-156828653 TAGAATATTTAGTTGCTTTATGG - Intergenic
940730657 2:157386491-157386513 TCTAAGCTATATTTACTTTAGGG - Intergenic
942550599 2:177112557-177112579 TTAATTCATTAGTTGCTTTATGG - Intergenic
942750210 2:179277917-179277939 TTTAAGCTGTATCTGCTTTAAGG - Intergenic
942769233 2:179495808-179495830 TCTAAGCTGTAACTGCTTTAGGG - Intronic
942967308 2:181912139-181912161 ATTATTCTTTTGTTGCTTTAAGG + Intronic
943354904 2:186841401-186841423 TTTAAGTTTTATTTGTTTTTTGG - Intronic
943677753 2:190732916-190732938 TTTAAATTTTATTTGCTTTCTGG - Intergenic
943923427 2:193739292-193739314 TCTAAGCTGTATCTGCTTTAGGG - Intergenic
945210366 2:207376037-207376059 TCTAAGCTGTATCTGCTTTAGGG - Intergenic
945218176 2:207456951-207456973 TTTAAGTTTTAAATGATTTATGG + Intergenic
946532074 2:220581379-220581401 TTTCAACTTTGATTGCTTTATGG + Intergenic
946910730 2:224457910-224457932 TCTAAGCTTAACTTGGTTTACGG - Intergenic
946984843 2:225259209-225259231 TTTAAGCTGTATCTTCTTTAGGG - Intergenic
947398729 2:229712801-229712823 AATAAGCTTTAGTTACTTGAAGG - Intronic
1168741933 20:199577-199599 TCTAAGCTATATCTGCTTTAGGG + Intergenic
1169628441 20:7598427-7598449 TCTAAGGTCTATTTGCTTTAGGG - Intergenic
1169994598 20:11542628-11542650 TTTAACCTTTAGATGTTTTCTGG + Intergenic
1170864297 20:20139331-20139353 TCTAAGCTTTATTAGCTTCATGG + Intronic
1172453934 20:35051091-35051113 ACTAAGCTCTAGTTGCCTTAAGG - Intronic
1174061811 20:47838410-47838432 TTTCACCTGTAGCTGCTTTATGG - Intergenic
1174761729 20:53213108-53213130 TTTCAGTTTTTGTTGATTTATGG + Intronic
1176917693 21:14645468-14645490 TCTAAGCTGTATCTGCTTTAGGG - Intronic
1177297554 21:19196620-19196642 TTTATGATTTAAATGCTTTAGGG + Intergenic
1177884188 21:26729204-26729226 TTTTAACTGTTGTTGCTTTAAGG + Intergenic
1177943476 21:27439978-27440000 TTTAAGTTTTAGTATATTTAGGG - Intergenic
1179085827 21:38216660-38216682 GTTAAGCTTTAAATTCTTTATGG - Intronic
1179425418 21:41274514-41274536 CTTAAGCTTTACTTGCAATACGG - Intronic
1183257812 22:36774039-36774061 TTTGAGCTTTAATTTCCTTATGG - Intronic
1184063432 22:42100320-42100342 GTTAAGCTGTAGTTGCTTTTTGG + Intergenic
1203291896 22_KI270736v1_random:2835-2857 TTTGAGCAATAGTTGTTTTAAGG + Intergenic
949156006 3:827798-827820 TGTAAGCTGTATCTGCTTTAAGG - Intergenic
949460352 3:4285189-4285211 TTTAAGCATAAGTTATTTTATGG - Intronic
949624579 3:5852062-5852084 ATTAACCTTTAGTTGTTTCAAGG + Intergenic
950178822 3:10896453-10896475 TTTGAGCCTCAGTTTCTTTATGG - Intronic
951102443 3:18704201-18704223 TCTATGCTGTATTTGCTTTAGGG - Intergenic
951204508 3:19910904-19910926 TCTAAGCTGTATCTGCTTTAGGG - Intronic
951424796 3:22531790-22531812 TTTCAGCTGTAGTGACTTTAGGG - Intergenic
951929709 3:27951820-27951842 TCTAAGCTGTATCTGCTTTAGGG + Intergenic
952383954 3:32825621-32825643 TTTAACCTTTATTAGTTTTATGG - Intronic
952984642 3:38768006-38768028 TTTTAACTGTTGTTGCTTTAAGG + Intronic
953046946 3:39302056-39302078 TTAAATATTTGGTTGCTTTATGG - Intergenic
954487901 3:50872227-50872249 TTTAAGCTGTGTCTGCTTTAGGG + Intronic
956475743 3:69618367-69618389 TTTAAGCTTCAGTTTCCTCATGG - Intergenic
957013293 3:75032723-75032745 TTCATGCTTTAGATGCTTTGAGG - Intergenic
957123429 3:76126564-76126586 TTAAATCTTTTCTTGCTTTAAGG - Intronic
957389327 3:79542489-79542511 CTGAAGCTTGAGTTTCTTTAAGG - Intronic
957860155 3:85937650-85937672 TTGAAGCCCTAGATGCTTTAGGG + Intronic
957900211 3:86480234-86480256 TCTAAGCTGTATCTGCTTTAGGG + Intergenic
958078479 3:88713638-88713660 TCTAAGCTTTATCTGCTTTAGGG - Intergenic
959157221 3:102681466-102681488 TTGAAGTTTTAGTAGCTTTATGG + Intergenic
959268503 3:104173629-104173651 TTAAAGCTATACTTACTTTAAGG + Intergenic
959279342 3:104317588-104317610 TGTAAGCTTTATCTGCTTTATGG - Intergenic
960239389 3:115322624-115322646 TCTAAGCTTTAGTTTCACTATGG + Intergenic
961248423 3:125477870-125477892 TTTCAGCTTTGTTAGCTTTATGG - Intronic
961316524 3:126039666-126039688 ATTAAGCTTTAGCTCCTCTAAGG + Intronic
961969907 3:130951673-130951695 TTAAATCTTCAGTTGCGTTAAGG + Intronic
962688503 3:137869738-137869760 TTTAAGCTGTATCTGCCTTAGGG - Intergenic
962862497 3:139418058-139418080 TCTAAGCTGTATCTGCTTTAGGG + Intergenic
964209164 3:154209447-154209469 TCTAAGCTGTATCTGCTTTAGGG + Intronic
964239609 3:154575530-154575552 TCTAAGCTGTATCTGCTTTAGGG - Intergenic
964438817 3:156682368-156682390 AGGGAGCTTTAGTTGCTTTAAGG + Intronic
964976044 3:162622089-162622111 TCTAAGCTGTATTTGCTTTAGGG + Intergenic
965730949 3:171772089-171772111 TTTAAGATCTAACTGCTTTAAGG - Intronic
966491219 3:180530304-180530326 TCTAAGCTGTATTTACTTTAGGG - Intergenic
968768224 4:2486113-2486135 TTTAATCCTTAGCTGCTTCATGG + Intronic
968833449 4:2945614-2945636 TTTCAGCTTTAGTAACTTTAAGG - Intronic
971720196 4:30234788-30234810 TTTCACTTTTAGTTCCTTTAGGG - Intergenic
971737630 4:30476473-30476495 TTTAATCATTTTTTGCTTTATGG + Intergenic
972908430 4:43782081-43782103 GTTAAGCTTTATTAGCTTTTAGG - Intergenic
974166352 4:58209254-58209276 TTTCAGCTTGAGTTTCTTCAGGG - Intergenic
976508981 4:85885140-85885162 TTTAGGATTTAGTTTCTTTTTGG + Intronic
977639890 4:99345185-99345207 TTCAAGCAGTAGTTGCTTTCTGG + Exonic
977789539 4:101083063-101083085 TTTAAGCTCTAATTCCTTTTGGG + Intronic
978745059 4:112183837-112183859 TTAAAGCTTTCTTTTCTTTAGGG - Intronic
978939289 4:114417021-114417043 CTTAAGCTTCATTTGCTTTATGG + Intergenic
979602240 4:122598865-122598887 TTTGGGGTTTAGTTTCTTTAAGG + Intergenic
980033411 4:127856449-127856471 TTTTATCTTTAGTTTCTATATGG + Intergenic
980087589 4:128407655-128407677 TTTTAACTGTTGTTGCTTTAAGG + Intergenic
980248217 4:130275652-130275674 TTTAAGTTTCAATAGCTTTAAGG - Intergenic
980443096 4:132872145-132872167 TGTAAGCTGTATTTGCTTTAGGG - Intergenic
980549491 4:134315695-134315717 TTTAAGCATTGTTTTCTTTAAGG + Intergenic
980660627 4:135854370-135854392 TCTAAGCTGTAGCTACTTTAGGG + Intergenic
981030826 4:140123965-140123987 TTCAAGCCTTAGTCGCTTTGGGG - Intronic
981117588 4:141010238-141010260 TAAAAGCTGTAGTTGCCTTAGGG + Intronic
981895781 4:149796869-149796891 TCTAAGCTGTATTTGCTTTAGGG - Intergenic
982024021 4:151233982-151234004 TTTATGCTGTAGTTGGTTCATGG + Intronic
982342089 4:154311002-154311024 TTTAGGCTTTGTGTGCTTTACGG - Intronic
982699659 4:158645762-158645784 TTGATGCTTTACTTGCTTGAGGG - Intronic
982964827 4:161892312-161892334 TTTAAGGTTAAATTGTTTTAGGG + Intronic
983136266 4:164085448-164085470 TTTTATCTTTAGTTTCATTATGG - Intronic
983329681 4:166308934-166308956 TGAAGGCTTTAGTTGCTTTATGG - Intergenic
983421631 4:167526283-167526305 TCTAAGCTGTATCTGCTTTAGGG + Intergenic
983561775 4:169108838-169108860 TCTAAGCTTTAGTAGGTGTAGGG - Intronic
983721074 4:170852012-170852034 TGTAATCTTTAGTTTCTTCAGGG - Intergenic
984020780 4:174482660-174482682 TTTAAATTTTAATAGCTTTAGGG - Intergenic
984673601 4:182521095-182521117 TCTAAGTTTTAGATGCTTCAAGG - Intronic
986657443 5:10029795-10029817 TCTAAGCTATATCTGCTTTAGGG + Intergenic
988022754 5:25644456-25644478 TTTAGGCTTTATTAGCTTCATGG + Intergenic
988132951 5:27129530-27129552 TTTCAGATTTAGGTGCTGTAAGG - Intergenic
988299611 5:29404883-29404905 TATAAGCTGTATCTGCTTTAGGG - Intergenic
988801893 5:34703727-34703749 TTTAAGCTTTAGTTGCTTTATGG + Intronic
989681376 5:44032977-44032999 TCTAAGCTGTATCTGCTTTAGGG - Intergenic
989722951 5:44552017-44552039 TCTAAGCTGTATCTGCTTTAAGG + Intergenic
990227241 5:53668423-53668445 TTTCAGATTCAGTTGCTTTCTGG + Intronic
990593029 5:57284499-57284521 TCTAAGCTGTATCTGCTTTAGGG - Intergenic
990923678 5:60995367-60995389 TCTAAGCTGTATCTGCTTTAAGG + Intronic
990945903 5:61249192-61249214 TTCAAGTTTTAGTTGCTTTCAGG + Intergenic
991180463 5:63745963-63745985 TCTAAGCTGTATCTGCTTTAGGG + Intergenic
992042225 5:72847470-72847492 TTTTAGCTTTAGTTGCCACATGG + Intronic
992247092 5:74836974-74836996 TTTCAGCCTTAGTTACCTTAGGG - Intronic
992587294 5:78253183-78253205 TCTAAGCTATATTGGCTTTAGGG - Intronic
992661885 5:78970077-78970099 CTTAAAGTTTAGTTGCTGTATGG - Intronic
992664290 5:78991069-78991091 TTTAATCATTAGTTTCTTTTAGG + Intergenic
992738435 5:79747168-79747190 TTTAATATTTTGGTGCTTTATGG + Intronic
992882371 5:81123219-81123241 TTCAAACTTTGGTTGGTTTAGGG + Intronic
993192266 5:84697117-84697139 TCTAAGCTGTATCTGCTTTAAGG - Intergenic
993441212 5:87959129-87959151 CTTAAGCTTCATTAGCTTTACGG + Intergenic
993623453 5:90193956-90193978 TCTAAGCTGTATCTGCTTTAGGG - Intergenic
994223638 5:97226313-97226335 TTTAAGCTTTATTACTTTTATGG - Intergenic
994477503 5:100289901-100289923 TCTAAGCTATATCTGCTTTAGGG + Intergenic
995197003 5:109381933-109381955 TTTAAAATTTGGTTTCTTTAAGG + Intronic
995241996 5:109895871-109895893 TTTCAGATTTAATTTCTTTAGGG + Intergenic
995664156 5:114522463-114522485 TTTACAATTTAGTTTCTTTATGG + Intergenic
996116274 5:119623824-119623846 TCTAAGCTGTATCTGCTTTAGGG + Intronic
996608641 5:125353052-125353074 TTTATGCTGTATTTGCTTTTGGG + Intergenic
996675158 5:126166903-126166925 TTTGAAATTTGGTTGCTTTATGG + Intergenic
996686624 5:126288843-126288865 TGTTAGGTTTAGTTGTTTTATGG - Intergenic
996927672 5:128846932-128846954 TCTAAGCTTTATCTACTTTAGGG - Intronic
996962553 5:129269129-129269151 TCTAAGCTGTATCTGCTTTAGGG + Intergenic
997242697 5:132319466-132319488 TTTAAGCCTTATTTGCTCTATGG - Intronic
998776201 5:145606145-145606167 TGTCAGATTTAGTAGCTTTAGGG + Intronic
999013485 5:148069723-148069745 CTTAAGCTTTATTAGCTTTAAGG + Intronic
999506569 5:152204652-152204674 TTTAAAATTTAGGTGCTTTCAGG + Intergenic
999724926 5:154429191-154429213 TAAAAGTTTTAGTTCCTTTATGG + Intergenic
1000892763 5:166818545-166818567 TTTAAGCTCTTGTTTCTTGAAGG + Intergenic
1001829624 5:174774523-174774545 TTTGAACCTTAGTTTCTTTATGG - Intergenic
1002306013 5:178283616-178283638 ATTAAGCTTTAGTGACTTTCTGG - Intronic
1003661829 6:8069485-8069507 TTTAAACTTTTGTTTCTTTGGGG - Intronic
1004204290 6:13576682-13576704 TTTTTGCTTTTGTTGCTTTTGGG + Intronic
1004818276 6:19336362-19336384 TTAAAGTTTTTGTTGTTTTATGG - Intergenic
1005331227 6:24752492-24752514 TTTAAACTTCAGTTTCTTAAAGG - Intergenic
1006963865 6:37961815-37961837 TCTAAGCTGTATCTGCTTTAGGG - Intronic
1007892870 6:45312195-45312217 TTTTAACTGTTGTTGCTTTAAGG - Intronic
1008017994 6:46542468-46542490 TCTAAGCTGTATCTGCTTTAGGG - Intergenic
1008227160 6:48935515-48935537 TCTAACCTGTAGTTGCATTATGG + Intergenic
1009619592 6:66056473-66056495 TTTATGCTTAAATTGCTATAAGG + Intergenic
1009783309 6:68297714-68297736 TCTAAGCTCTATCTGCTTTATGG - Intergenic
1010529032 6:76943052-76943074 TCTAAGCTGTATGTGCTTTAGGG - Intergenic
1010602632 6:77849554-77849576 TATAAGCGTTAGTTTCTTTTTGG + Intronic
1010639580 6:78307991-78308013 TCTAAGCTGTATCTGCTTTAGGG + Intergenic
1011268646 6:85552640-85552662 TTTTATCTTTAGTTTCTGTAGGG - Intronic
1011496045 6:87937407-87937429 TTTAAGCTTTATTAGCTTCATGG - Intergenic
1011635284 6:89366547-89366569 TTCAAGTATAAGTTGCTTTAGGG + Exonic
1012447927 6:99325829-99325851 TTTACACTTTAGATGCTTTTCGG - Intronic
1012498667 6:99863784-99863806 TTTAAGCTTCCTTTGCCTTATGG - Intergenic
1012761747 6:103310702-103310724 TTTAAGCTATACCTGGTTTAGGG - Intergenic
1013617364 6:111857744-111857766 TTAAAACTTTAGTTGCTTCAGGG + Intronic
1013685975 6:112583410-112583432 TTTAGGCTTTTGTTCTTTTATGG + Intergenic
1014342972 6:120231331-120231353 TCAAATATTTAGTTGCTTTATGG - Intergenic
1014390383 6:120855886-120855908 TTTAAGCTCTCATTGATTTATGG + Intergenic
1014991348 6:128081740-128081762 TATAAACTTTAGTAGATTTAGGG + Intronic
1015247446 6:131090581-131090603 TATCAGCTTAAGTTGCTTTGGGG - Intergenic
1015450604 6:133362851-133362873 CTTCAGCTTTAGCTTCTTTAAGG + Intronic
1016067725 6:139701140-139701162 TTTAACATTTTATTGCTTTATGG + Intergenic
1016277227 6:142368499-142368521 TTGAAGCTTGAGTTTCTTTAGGG - Intronic
1016618991 6:146085820-146085842 TTTAGGATTTAGTTGCTTTGAGG + Intronic
1016845645 6:148565664-148565686 CTTCAAATTTAGTTGCTTTATGG + Intergenic
1017379785 6:153814510-153814532 TTTAAGCTGTTTCTGCTTTAGGG - Intergenic
1018450640 6:163904052-163904074 TTGAAGATTTAGATGCTTGAAGG - Intergenic
1018535965 6:164819073-164819095 TCTAAGCTGTATCTGCTTTAGGG - Intergenic
1018885818 6:167935690-167935712 TTTAAGGATTACTTGCTTAAAGG - Intronic
1020491096 7:8785377-8785399 TTTACACTTTAATTGCTTTAGGG - Intergenic
1021562086 7:21978630-21978652 TTTAAGCTTAATTAGCTTCAAGG + Intergenic
1021803370 7:24330376-24330398 TTTAAGCCTTAGCTGGTTCATGG + Intergenic
1021815433 7:24442844-24442866 TTTAAACTTTAGTTTCTTCCTGG + Intergenic
1022061246 7:26797496-26797518 TCTAAGCTGTATCTGCTTTAGGG - Intronic
1022080350 7:27013531-27013553 TCTAAGCTGTATCTGCTTTAGGG - Intergenic
1023264464 7:38391702-38391724 TTTATCCTTTTTTTGCTTTAAGG - Intronic
1023700731 7:42889383-42889405 TTTAGGCTTTAGTTGCTTGAAGG - Intergenic
1024090197 7:45932496-45932518 TTTATGTTGTAGTTGTTTTATGG + Intergenic
1024415147 7:49097241-49097263 TCTAAGCTGTATTTTCTTTAGGG - Intergenic
1026291452 7:69010071-69010093 TTTAACCCTAAGTTTCTTTAAGG + Intergenic
1027525748 7:79266855-79266877 GTTATCCTTTAGTTTCTTTAGGG - Intronic
1027555054 7:79653782-79653804 TTTAAGCTATAGTTGCCATTTGG + Intergenic
1027941887 7:84692879-84692901 TTTAATATTTAGTATCTTTAAGG - Intergenic
1028001517 7:85502934-85502956 TCTAAGCTTTATCTGCTTTAGGG - Intergenic
1028098284 7:86789486-86789508 TTTAAGCTTGAGATGCACTATGG + Intronic
1028639288 7:93025055-93025077 TTTGAGCCTCAGCTGCTTTAGGG - Intergenic
1028950445 7:96629821-96629843 TCTAAGCTGTATGTGCTTTAGGG + Intronic
1029797160 7:102908593-102908615 TCTAAGCTGTATCTGCTTTAGGG + Intronic
1030086760 7:105822381-105822403 TTTGGGCTTGAGTTGCTTTGTGG + Intronic
1031090235 7:117346019-117346041 TTTAAACTATTGTTGCTTTAAGG + Intergenic
1031280528 7:119795103-119795125 TCTAAGCTCTATCTGCTTTAAGG + Intergenic
1031293655 7:119973409-119973431 TATCATTTTTAGTTGCTTTAGGG - Intergenic
1033050329 7:137998414-137998436 TTTAAACATTAGCTGCTTTCAGG + Intronic
1034015254 7:147576730-147576752 TTTAATTGTTAGTTGCATTATGG - Intronic
1034124705 7:148661067-148661089 TTTAAGGTTTAGATTCTTAAAGG - Intergenic
1035084391 7:156246109-156246131 TCTAAGCTGTATCTGCTTTAGGG + Intergenic
1035543774 8:462882-462904 TTTAAACTTCAATAGCTTTAGGG - Intronic
1037102354 8:15062279-15062301 TATAAGCTTAAGTTGCATAATGG - Intronic
1037993583 8:23337762-23337784 TTTAAGCTTCATTAGCTTTAAGG + Intronic
1038034180 8:23673209-23673231 TTTAAGCTTTTCTGGCTTTGGGG + Intergenic
1038109464 8:24479462-24479484 TTAAAGCTTTTGTTCCTTGAGGG + Intronic
1038225431 8:25652939-25652961 TTGAATATTTGGTTGCTTTATGG + Intergenic
1038483391 8:27917187-27917209 TTTAAGCTTTGGATTCTTGATGG - Intronic
1039535265 8:38305242-38305264 TTTTACCTTTACTTGCTTTGTGG + Exonic
1039640661 8:39218053-39218075 TTTAAGCCATATTTGCATTAGGG + Intronic
1040095830 8:43441287-43441309 TCTAAGCTGTATCTGCTTTAGGG - Intergenic
1041319228 8:56596216-56596238 TTTTTCCTTCAGTTGCTTTAGGG + Intergenic
1041434131 8:57818793-57818815 TTAAATATTTGGTTGCTTTATGG - Intergenic
1041607743 8:59803466-59803488 TTTTGGCTTTAGTAGTTTTAAGG - Intergenic
1042033954 8:64509344-64509366 TTTAAGATCTAGCTACTTTAGGG - Intergenic
1043132655 8:76480878-76480900 GTTTAGCTTTAGTGGCTTTGGGG + Intergenic
1044080504 8:87876395-87876417 TTTATGCTTTAGTTTCTTGAGGG + Intergenic
1044192927 8:89341716-89341738 TCTAAGCTGTATCTGCTTTACGG + Intergenic
1045132650 8:99173616-99173638 TTTAAGGCTTAGTAGTTTTAAGG - Intronic
1045207231 8:100055442-100055464 TATAAGCTGTATCTGCTTTAGGG - Intronic
1046169537 8:110486524-110486546 TCTAAGCTGTATCTGCTTTAGGG - Intergenic
1046777933 8:118183681-118183703 TTTTAATTTTAGTAGCTTTAGGG + Intergenic
1047261559 8:123265941-123265963 TTTAATCTTTAGTGTCATTAAGG - Intronic
1047394753 8:124485687-124485709 TTTAAGCCTTAGTTGTCTTGAGG + Intronic
1048901980 8:139047407-139047429 TTTAAATTTTATTGGCTTTATGG + Intergenic
1048902235 8:139049926-139049948 TTTAAATTTTATTGGCTTTATGG + Intergenic
1049144315 8:140986992-140987014 TTTATGAGTTTGTTGCTTTACGG - Intronic
1049202647 8:141349275-141349297 TTTTACCTTTTGTTGCTTTGGGG - Intergenic
1049511888 8:143031608-143031630 GTTATGCTTTAGTTTCTATAGGG - Intergenic
1049897599 9:124174-124196 GTTAAGCTTCTGTTTCTTTAGGG - Intronic
1050411484 9:5370838-5370860 TTTAACCTTAACTTGCTTGACGG + Intronic
1050460424 9:5872951-5872973 TTTCAGTTTTAGGCGCTTTATGG - Intergenic
1050795471 9:9535256-9535278 TTCTAGCTTTATTTGCTTTTAGG + Intronic
1052214502 9:25950386-25950408 TCTAAGCTGTATTTGCTTTAAGG + Intergenic
1052258669 9:26490324-26490346 TATAAGCTGTATCTGCTTTAGGG + Intergenic
1052476963 9:28972102-28972124 TCTAAGCTGTTTTTGCTTTAGGG - Intergenic
1052733027 9:32311470-32311492 TCTAAGCTGTATCTGCTTTAGGG - Intergenic
1053619580 9:39801844-39801866 TTCAAACTTTAGATGATTTAGGG + Intergenic
1053740690 9:41134462-41134484 GTTAAGCTTCTGTTTCTTTAGGG - Intronic
1054264578 9:62905599-62905621 TTCAAACTTTAGATGATTTAGGG - Intergenic
1054687660 9:68296838-68296860 GTTAAGCTTCTGTTTCTTTAGGG + Intronic
1055073727 9:72193314-72193336 TCTAAGCTATATCTGCTTTAGGG + Intronic
1055243638 9:74216196-74216218 TTTAAGCTGTATCTTCTTTAGGG + Intergenic
1056329458 9:85509808-85509830 TTTACTCTTTAGATGCTTTAGGG - Intergenic
1056424547 9:86464158-86464180 TCTAAGCTGTATTTGCTTTAGGG + Intergenic
1056662029 9:88550851-88550873 TGTAATCTTTAGTTTCTGTAGGG + Intronic
1059828439 9:118061668-118061690 TTTAAACTTTAGTTGTTCTAGGG + Intergenic
1059878119 9:118658877-118658899 TCTAAGCTTTATTAGATTTAAGG - Intergenic
1061732122 9:132623675-132623697 TCTAAGCCTTAGTTTCTTTTCGG - Intronic
1061915447 9:133750703-133750725 TCTAAGCTGTATCTGCTTTAGGG + Intergenic
1203782415 EBV:108061-108083 TTTAAGTTTTTATTGCATTAGGG - Intergenic
1203491298 Un_GL000224v1:107909-107931 TTTAAGCTTGAGGTGCCTTTCGG - Intergenic
1203503922 Un_KI270741v1:49779-49801 TTTAAGCTTGAGGTGCCTTTCGG - Intergenic
1185790013 X:2922130-2922152 TTTCAGAATTAGTTGCATTATGG + Intronic
1187099404 X:16177359-16177381 TTTAAGCTTTAGTGGCTTCATGG + Intergenic
1187589054 X:20695531-20695553 TTTTAACTTCTGTTGCTTTAAGG - Intergenic
1187610455 X:20938230-20938252 TCTAAGCTGTATCTGCTTTAGGG + Intergenic
1187618576 X:21026237-21026259 TCTAAGCTGTATCTGCTTTAGGG + Intergenic
1187845058 X:23526006-23526028 TATAAGCTATATCTGCTTTAGGG - Intergenic
1188742856 X:33808232-33808254 TCTAAGCTGTATCTGCTTTAGGG + Intergenic
1188903981 X:35769558-35769580 TTTCAGGTTTAGTTGCCTCATGG + Intergenic
1188933726 X:36147672-36147694 TTCCAACTTTAGTTTCTTTAAGG - Intergenic
1189098228 X:38162066-38162088 TGTTGGCTTTAGATGCTTTAAGG + Intronic
1189112620 X:38308818-38308840 ATTAAGCTTTAGTTTCTAGATGG - Intronic
1189227953 X:39429230-39429252 TTTAAGCTTCATTAGCTTCATGG - Intergenic
1189657882 X:43266421-43266443 TCTAAGCTATATCTGCTTTAGGG + Intergenic
1189690429 X:43612309-43612331 TCTAAGCTGTATCTGCTTTAGGG + Intergenic
1189868673 X:45359694-45359716 TCTAAGCCTTACCTGCTTTAGGG + Intergenic
1190614738 X:52218253-52218275 TTTAAGCTGTATTTGCTTTAGGG - Intergenic
1190919430 X:54838471-54838493 TCTAAGCTGTATCTGCTTTAGGG + Intergenic
1191694999 X:63979987-63980009 TCTAAGCTTTATCTGCTTTCAGG - Intergenic
1191829705 X:65402780-65402802 TGTAAGCTGTATCTGCTTTAGGG - Intronic
1191855668 X:65623936-65623958 TTTCTTCTTGAGTTGCTTTAGGG + Intronic
1192406175 X:70888027-70888049 TCTAAGCTGTATCTGCTTTAGGG - Intronic
1192822276 X:74657821-74657843 TCTAAGCTCTATCTGCTTTAGGG + Intergenic
1192853537 X:74982682-74982704 TATAAGCTGTATCTGCTTTAGGG - Intergenic
1193000495 X:76557571-76557593 TCTAAGCTGTATCTGCTTTAGGG + Intergenic
1193007767 X:76640338-76640360 TTTTAACTGTTGTTGCTTTAAGG + Intergenic
1193175297 X:78385091-78385113 TCTAAGCTATATTTGCTTTAGGG - Intergenic
1193619945 X:83739099-83739121 TCTAAGCTGTATCTGCTTTAGGG - Intergenic
1193830827 X:86288074-86288096 TCTAAGCTGTATGTGCTTTAGGG + Intronic
1193981744 X:88188829-88188851 TCTAAGCTGTATCTGCTTTAGGG - Intergenic
1194112767 X:89855008-89855030 TCTAAGCTGTATCTGCTTTAGGG - Intergenic
1194274685 X:91865202-91865224 TCTAAGCTGTATGTGCTTTAGGG + Intronic
1194358391 X:92917557-92917579 TCTAAGCTTTATCTGCTTTTGGG + Intergenic
1194360928 X:92949799-92949821 TCTAAGCTGTATCTGCTTTAAGG + Intergenic
1194826563 X:98571988-98572010 TTTATGATTTATTTTCTTTATGG - Intergenic
1194839612 X:98725095-98725117 TCTAAGCTGTATGTGCTTTAGGG + Intergenic
1195014519 X:100765520-100765542 TCTAAGCTTTATCTACTTTAGGG + Intergenic
1195059885 X:101183957-101183979 TTTTACCTATAGATGCTTTACGG - Intergenic
1195648206 X:107257082-107257104 TTAATGCTCTTGTTGCTTTATGG - Intergenic
1195821046 X:108945783-108945805 TCTAAGCTGTATCTGCTTTAGGG + Intergenic
1195849018 X:109263496-109263518 TTTAAGCTGTATCTACTTTAGGG + Intergenic
1196214387 X:113034246-113034268 TCTAAGCTATATCTGCTTTAGGG + Intergenic
1196215975 X:113051656-113051678 TCTAAGCTTTATCTGCATTAGGG - Intergenic
1196233378 X:113252160-113252182 TCTAAGCTGTATTTTCTTTAGGG + Intergenic
1196304778 X:114087972-114087994 TTTAAGCTTCATCTGGTTTAGGG - Intergenic
1196494243 X:116306164-116306186 TCTAAGCTGTATCTGCTTTAGGG + Intergenic
1196651502 X:118172766-118172788 TTTAGGCTTTAGCAACTTTAGGG - Intergenic
1196660659 X:118265114-118265136 TCTAAGCTGTAACTGCTTTAGGG - Intergenic
1197096804 X:122605435-122605457 TCTAAGCTGTATCTGCTTTAGGG - Intergenic
1197407680 X:126072897-126072919 TATAAGTTTTAGGTGGTTTATGG - Intergenic
1197435546 X:126424344-126424366 TCTAAGCTGTATTTGCTTTAGGG + Intergenic
1197677740 X:129347978-129348000 TTTAAGCTGTATCTGCTTTAGGG - Intergenic
1197987008 X:132277817-132277839 TCTAAGCTGTATCTGCTTTAGGG + Intergenic
1198059411 X:133029946-133029968 TTTAAGCTTGAGATGTCTTAGGG - Intronic
1198545640 X:137690011-137690033 CTTAAGCCTCATTTGCTTTATGG - Intergenic
1198702429 X:139412943-139412965 ATTAAGCTGTATCTGCTTTAGGG + Intergenic
1198785330 X:140282537-140282559 TCTAAGCTGTATCTGCTTTAGGG + Intergenic
1199159807 X:144596125-144596147 TCTAAGCTGTATCTGCTTTAGGG + Intergenic
1199176036 X:144787912-144787934 TATAAGCTGTATCTGCTTTAGGG - Intergenic
1199177789 X:144811730-144811752 TCTAAGCTGTATCTGCTTTAGGG - Intergenic
1199196432 X:145036811-145036833 TCTAAGCTGTAGCTGCTTTAGGG + Intergenic
1199308557 X:146296676-146296698 TCTAAGCTGTATCTGCTTTAGGG + Intergenic
1199435817 X:147811420-147811442 TTTGGGCTTTAGTTGGTCTAAGG + Intergenic
1200465420 Y:3509819-3509841 TCTAAGCTGTATCTGCTTTAGGG - Intergenic
1200591928 Y:5086603-5086625 TCTAAGCTGTATGTGCTTTAGGG + Intronic
1200666569 Y:6033248-6033270 TCTAAGCTTTATCTGCTTTTGGG + Intergenic
1200669128 Y:6065611-6065633 TCTAAGCTGTATCTGCTTTAAGG + Intergenic
1201058667 Y:10021197-10021219 TTTAAGATGGAGTTGCTTAAAGG - Intergenic
1201225880 Y:11818817-11818839 TTTAAACTTTAATTACTTTAAGG - Intergenic
1201284301 Y:12365811-12365833 TTTCAGAATTAGTTGCATTATGG - Intergenic
1201793893 Y:17873742-17873764 TACAAGCTTTACTTGCTTTGAGG - Intergenic
1201807661 Y:18032244-18032266 TACAAGCTTTACTTGCTTTGAGG + Intergenic
1202355276 Y:24041559-24041581 TACAAGCTTTACTTGCTTTGAGG - Intergenic
1202515502 Y:25628550-25628572 TACAAGCTTTACTTGCTTTGAGG + Intergenic