ID: 988806144

View in Genome Browser
Species Human (GRCh38)
Location 5:34742622-34742644
Sequence CAGCAAACTGCAGTAGTGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 226}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988806144_988806145 21 Left 988806144 5:34742622-34742644 CCATACACTACTGCAGTTTGCTG 0: 1
1: 0
2: 2
3: 40
4: 226
Right 988806145 5:34742666-34742688 TTTTGTTTTGTTTTTTAAGATGG 0: 39
1: 1368
2: 4249
3: 100150
4: 84736

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988806144 Original CRISPR CAGCAAACTGCAGTAGTGTA TGG (reversed) Intronic
900742791 1:4340840-4340862 CAGGAAACAGCAGCAATGTAAGG - Intergenic
902050072 1:13556643-13556665 CAGCAAGCTGCCCTAGGGTAGGG + Intergenic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
908670896 1:66546435-66546457 CAACAAACTGTAGTAGTGGTTGG - Intronic
908717659 1:67087517-67087539 CAGCAAACAGAAGTGGTGGACGG - Intergenic
908723227 1:67148228-67148250 CGGCAATCAGCAGTAGTGGACGG + Intronic
912603646 1:110965122-110965144 CAGCATAATGCAGTAGTACATGG - Intergenic
915663896 1:157427211-157427233 CACCAAACTGCAGAAGAGTCTGG - Intergenic
916518294 1:165540729-165540751 CATCAAACTTCAGTTGTGAAGGG - Intergenic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
923891473 1:238219822-238219844 CAACAGACTTCAGTAGTCTATGG + Intergenic
923925024 1:238616673-238616695 CAGCTGAATGCAGTAGTGAATGG - Intergenic
1065222798 10:23513377-23513399 AGGCAAACAGCAGTAGTGGACGG + Intergenic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068988851 10:63131015-63131037 CAGCAAACAGCGGTGGTGGACGG + Intergenic
1069037966 10:63665000-63665022 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1070678174 10:78429371-78429393 CAGAAATCTGCAGAATTGTAGGG + Intergenic
1071082706 10:81831312-81831334 CAGCAAATAGCAGTGGTGGACGG + Intergenic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1074363088 10:112838293-112838315 CAGCCACCTGCAGTAGTCTCTGG - Intergenic
1074379253 10:112965336-112965358 CAGCAGAATGCAGTAGAGGAGGG + Intronic
1074745762 10:116530687-116530709 CAGAAAACTTCATGAGTGTAGGG - Intergenic
1075716066 10:124556130-124556152 CAGTAAACTGAAGAAGTGAAAGG + Intronic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1078354634 11:10624731-10624753 CAGCACACTGGAGTCGGGTAGGG + Intronic
1080495644 11:32815828-32815850 GAGGAAACTGCAGGTGTGTAAGG - Intergenic
1080881486 11:36325361-36325383 TAGCAAACGGCAGTGGTGGACGG + Intronic
1081069741 11:38595865-38595887 CAGCAAATAGCAGTGGTGGATGG + Intergenic
1081070858 11:38606845-38606867 CAGCAAACAGCAGTGGTGGAAGG - Intergenic
1084299113 11:68234536-68234558 CAGAAAACTACAGGAGGGTATGG - Intergenic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1086527354 11:87743593-87743615 AAGAAATCTGCAGAAGTGTATGG + Intergenic
1088215807 11:107507784-107507806 AAGAACACTGCAGTAGTGAAGGG + Intronic
1088242923 11:107789629-107789651 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1089160248 11:116431895-116431917 CAGCAAAATGGAGTTGTGAAGGG - Intergenic
1092754881 12:11753806-11753828 CAGCAAGCTGCAGGAGGGAAAGG - Intronic
1094240024 12:28211860-28211882 TAGCAAACTGTAATATTGTAGGG - Intronic
1095226861 12:39687524-39687546 CAGCAAACTTCACTATTGTAAGG + Intronic
1095426861 12:42084133-42084155 AAGCAAACTGATGTAGTGTGAGG + Exonic
1096175996 12:49519580-49519602 AAGCAGACTGCTGTAGTGTGGGG - Intronic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1097376748 12:58852228-58852250 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097377757 12:58859357-58859379 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097643016 12:62205083-62205105 CAGCAAACTGCAGCAGCCCATGG - Intronic
1098639878 12:72825637-72825659 CAGCAAACAGCAGTGGTAGACGG + Intergenic
1098984869 12:77001448-77001470 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1104850971 12:131873564-131873586 CAGCAAGCAGCAGTGGTGGATGG + Intergenic
1106359676 13:29019026-29019048 CAGTAACCTACAGTTGTGTAAGG - Intronic
1107156430 13:37172407-37172429 CAGCAAACAGCAGTGGCGGAGGG + Intergenic
1107991200 13:45820400-45820422 CACCAGAATGCAGTAGTGTGAGG - Intronic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1109931290 13:69221993-69222015 CAGCAAACAGTAGTGGTGGACGG - Intergenic
1110660990 13:78059440-78059462 CGGCAAACAGCAGTGGTGCATGG - Intergenic
1110987077 13:81984444-81984466 TAGCAAACAGCAGTGGTGGATGG + Intergenic
1111530472 13:89530163-89530185 CACAAAACTGCAGGAGTGAAAGG + Intergenic
1111536801 13:89612121-89612143 CGGCAAACGGCAGTGGTGGACGG + Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1111910276 13:94303076-94303098 CAGCAAACAGCAGTGGTGGATGG + Intronic
1113872444 13:113567796-113567818 CAGCAAACCGGAGAAGTGAAGGG - Intergenic
1114384823 14:22243779-22243801 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1116720346 14:48487993-48488015 CTGCAAAATCCATTAGTGTATGG + Intergenic
1117087926 14:52220601-52220623 CAGAAAAAGGCAGAAGTGTATGG - Intergenic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1119141254 14:72269336-72269358 AGGCAAACTGCAGTACTCTAAGG - Intronic
1119869794 14:78007212-78007234 AAGCAAACTGCTATATTGTAAGG - Intergenic
1120107987 14:80517978-80518000 CAGCAAACAGCAGTGGTGGACGG + Intronic
1120317318 14:82912174-82912196 TAGCAAACAGCAGTAGTGCAGGG + Intergenic
1122056879 14:99105080-99105102 AAGGAAACTGCAGGAGTGTATGG + Intergenic
1122178982 14:99941423-99941445 CAGCCTACTGCAGAAGTGCAGGG + Exonic
1123736015 15:23183737-23183759 CAGCAAACAGCAGTAGTAAGAGG - Intergenic
1123982744 15:25619029-25619051 CAGCAAACTGCAGCTGTGGGAGG - Intergenic
1126153889 15:45547395-45547417 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1128685033 15:69677759-69677781 CAAAAAACTGCAGTGGTGTAAGG - Intergenic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1130346349 15:83049473-83049495 CTTCAAATTGCAGTAGTGTTAGG - Intronic
1131420109 15:92298265-92298287 CAGCAAATAGCAGTGGTGGACGG - Intergenic
1131579981 15:93633801-93633823 AAGCTATCTGCAGTAGTCTAGGG + Intergenic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1134199515 16:12186483-12186505 CATCACACTGCGGTCGTGTAAGG - Intronic
1135416444 16:22271619-22271641 CCTCAAACTCCTGTAGTGTATGG - Intronic
1136257129 16:29048823-29048845 TGGCAAAGTGCAGTAGTGAACGG + Intronic
1138422346 16:56907480-56907502 CTGAAAACTGCTGTCGTGTATGG - Intronic
1139716151 16:68814772-68814794 TAGCCAAGCGCAGTAGTGTATGG + Intronic
1141298453 16:82791595-82791617 CAGCAAACAACAGTGGTGGATGG - Intronic
1143400031 17:6637855-6637877 CAGCAAACTGCAGGAATGCCTGG - Intronic
1144433015 17:15212507-15212529 CAGCAAGCTGCAGGGGTGAAGGG + Intergenic
1146275090 17:31511473-31511495 CATCATACTGCAGTACAGTATGG + Intronic
1148431398 17:47646705-47646727 CAGCAAACTGCTGGAGAGCAGGG + Intergenic
1148826730 17:50399327-50399349 CAGCAAACAGCAGTAGTGGACGG + Intergenic
1148988388 17:51644294-51644316 CAGCAAACTGAGGTGGTGCAGGG - Intronic
1149138259 17:53397028-53397050 CTGTAAGCTGCAATAGTGTATGG - Intergenic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1152058978 17:78054832-78054854 CAGTAGTCTGCAGTGGTGTATGG - Intronic
1152058980 17:78054862-78054884 CAGTAGTCTGCAGTGGTGTATGG - Intronic
1153400773 18:4682045-4682067 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1155749242 18:29399246-29399268 CGGCAAACGGCAGTGGTGGATGG + Intergenic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1162918428 19:13886380-13886402 CAGGAGACTGCAGTGGTGTCAGG - Intronic
1164173170 19:22745520-22745542 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1164727331 19:30475005-30475027 AAGCAAACTGCAGAATTATAGGG - Intronic
1164856395 19:31527868-31527890 CAGCAAAATGCAGTTGTAGAGGG - Intergenic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
925023807 2:592583-592605 CAGCAAACAGCAGTGGTGGAGGG - Intergenic
927486908 2:23494882-23494904 CAGGATACTGCAATAGTGCAAGG - Intronic
927798408 2:26073284-26073306 CAGCAAACTGCTGTTTTGTCTGG + Intronic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
935748347 2:106209327-106209349 CAGCAAACAGCAGTGGTGGATGG - Intergenic
938660968 2:133486994-133487016 CAGCACACTGCAGGAGTAAAAGG + Intronic
939067121 2:137496944-137496966 CAGCAAATTGCAGAAGTGGAAGG + Intronic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
939221398 2:139306346-139306368 CAGCGAATTGCAGTAGGTTACGG + Intergenic
941080618 2:161056562-161056584 CAGGACACAGCAGTAGGGTACGG + Intergenic
945981811 2:216318319-216318341 CAGCCAACTGCTGTAGGGGACGG + Intronic
948981143 2:241495480-241495502 CAGCACACTGCAGGGGTGGAAGG + Exonic
1169561098 20:6802007-6802029 CATCAGACTGCAGCAGTTTAAGG - Intergenic
1170953025 20:20953808-20953830 CAGCAAATTGCTGCAGTGGAAGG + Intergenic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1176931957 21:14823998-14824020 CACCAAAATGCATTAGTCTATGG + Intergenic
1177263980 21:18760153-18760175 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1178044218 21:28676101-28676123 AAGCAAACTGCCCTGGTGTATGG + Intergenic
1178563262 21:33659017-33659039 CAGGAAACTGCAGGATTGGAGGG + Intronic
1179207615 21:39297382-39297404 CAGCAAGCTGCCCTAGGGTAGGG - Intronic
1179444728 21:41423260-41423282 CAGCAAATGGCAGTGGTGGATGG + Intronic
1182248349 22:28978997-28979019 CAGCAAACTAAAGTAATGGAGGG - Intronic
1185087180 22:48747123-48747145 CAGCAAAGTGCATTAGGGCAGGG - Intronic
949237884 3:1832586-1832608 CAGGAAACTGCAGCAGCGGAGGG - Intergenic
949811676 3:8012972-8012994 CAGCAAACAGCAGTGGTGGATGG + Intergenic
950309860 3:11947927-11947949 CAGGAACCTGCAGCAGTGAATGG + Intergenic
951016256 3:17735811-17735833 CAGCAAACAGCAGTGGTGGATGG + Intronic
953943209 3:47120755-47120777 CAGCAAAATGCAGAACAGTATGG - Exonic
955063248 3:55512766-55512788 CAGCAAACTGCTTTTGGGTAAGG + Intronic
957000509 3:74877945-74877967 CAGCAAACAGCAGTGGTGGATGG + Intergenic
957687039 3:83515284-83515306 CAGCAAACAGCAGTGGTGGACGG - Intergenic
958424501 3:93965270-93965292 CGGCAAACAGCAGTTGTGGACGG - Intronic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
962450291 3:135508304-135508326 CAGCAAACTTCCCTAGTTTAGGG + Intergenic
962621872 3:137188346-137188368 CAGCTGAGTGCAGTAGGGTATGG + Intergenic
963915312 3:150854370-150854392 CAGCAAACAGCAGTAGCAGACGG - Intergenic
963975113 3:151471714-151471736 CAGCAACCTGCAATAGTAAAAGG - Intergenic
964202432 3:154133136-154133158 CAGCAATTTGCAGTAATTTATGG + Intronic
965225530 3:165984013-165984035 CAGTAAATTTCAGTAGGGTAGGG - Intergenic
965647066 3:170895302-170895324 CAACAAAATCCACTAGTGTATGG + Intronic
965779873 3:172273900-172273922 CAACAAACAGCGGTAGTTTATGG + Intronic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969352153 4:6604122-6604144 CAGGAAACGGCAGGAGTGTCAGG + Intronic
969969901 4:11035567-11035589 CAGCAAACAGCAACAGTTTATGG - Intergenic
970738116 4:19198142-19198164 CCGCAAACAGCAGTGGTGCACGG + Intergenic
970847973 4:20565490-20565512 CAGCACACTGCAGAAATGAATGG - Intronic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
974475525 4:62373976-62373998 GTGAAAGCTGCAGTAGTGTAAGG + Intergenic
974487853 4:62526898-62526920 CAGCAAACAGCAGTGGTGGACGG + Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975418825 4:74138679-74138701 CAGCAAACAGCAGTGGTGGATGG + Intronic
975957820 4:79863079-79863101 CAGCAAATTGCAGTGGCATATGG + Intergenic
975977267 4:80113558-80113580 CTGAAAAAGGCAGTAGTGTAAGG - Intronic
976190167 4:82479711-82479733 CAGCAATCAGCAGTGGTGGATGG - Intergenic
976515229 4:85956792-85956814 CAGCAAAAAGCAGTGGTGGATGG + Intronic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
980190519 4:129519325-129519347 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980385186 4:132079757-132079779 CAGTAAACTGAAGCAGTGGAAGG + Intergenic
980386303 4:132090774-132090796 CAGCAAACAGCAGTGATGGATGG + Intergenic
980523646 4:133961712-133961734 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
981639939 4:146929826-146929848 CAGCAAAGTGCAATAGAATAAGG + Intronic
983431956 4:167661577-167661599 CAGAAAACTGCAGTATTTTAAGG - Intergenic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988806144 5:34742622-34742644 CAGCAAACTGCAGTAGTGTATGG - Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989717696 5:44483491-44483513 CAGCAAATAGCAGTGGTGGACGG - Intergenic
990375975 5:55171442-55171464 CACAAAACTGCAGCAGTGTTTGG + Intronic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
992538084 5:77732297-77732319 CAGCAAAGTGCAGTAAGATAAGG - Intronic
993598575 5:89890858-89890880 CAGCAAAATGCTGTAATATAGGG - Intergenic
993992484 5:94676661-94676683 CAGCATACTGCATTCGTGTAGGG - Intronic
995574228 5:113512907-113512929 CAGCTAACTGCAGGAGAGTTGGG + Intergenic
996913041 5:128677979-128678001 CATGAAACTGCATTAGTGTGTGG + Intronic
1000984651 5:167853717-167853739 AAGCAAATTGCAATAGTCTATGG - Intronic
1002966649 6:1972941-1972963 CAGCAATCTGGTGAAGTGTATGG - Intronic
1004236359 6:13878455-13878477 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1005640543 6:27792163-27792185 CAGCAATCAGCTGTGGTGTAGGG - Intergenic
1007249363 6:40485292-40485314 CCACAAACTGCAGTAGGGAAGGG - Intronic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1008847512 6:55985629-55985651 CAGAAAACTGCATAGGTGTAAGG + Intergenic
1010202149 6:73291644-73291666 CAACAGAATGCAGTGGTGTATGG + Intronic
1011190324 6:84720755-84720777 CAGCGAACAGCAGTGGTGGATGG + Intronic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1015632764 6:135247944-135247966 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1017948037 6:159111843-159111865 CAGTAGTCTACAGTAGTGTATGG - Intergenic
1017948042 6:159111953-159111975 CAGTAGCCTACAGTAGTGTATGG - Intergenic
1018481995 6:164200297-164200319 CAGAAAACTGCATTGGTGGATGG + Intergenic
1020971157 7:14941145-14941167 CAGCTAACTTCAGTAGGGCATGG + Intronic
1021144253 7:17065920-17065942 CAGCGAACAGCAGTGGTGGACGG - Intergenic
1021625874 7:22592522-22592544 AAGCAGACTGCAGTATTGGAGGG + Intronic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1024148021 7:46536784-46536806 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1025041388 7:55648986-55649008 CAGTAAACATCAGTAGTGAAGGG - Intergenic
1026410815 7:70119858-70119880 CAGCACACTGCTTTAGAGTATGG - Intronic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028338247 7:89684821-89684843 CAGCATACTGTTGGAGTGTAAGG - Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028954455 7:96673535-96673557 TAGCATACTGCAGTATTGTTGGG - Intronic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1030431253 7:109452177-109452199 CGGCAAACTGCAGTGGTGGACGG - Intergenic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1033129432 7:138733239-138733261 CAGCAAACAGCAATCCTGTATGG + Intronic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034614399 7:152402864-152402886 CAGTTAAGTGCAGTAGTGAAAGG - Intronic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034707081 7:153155210-153155232 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1041766822 8:61427474-61427496 CAGTAAACAGCAGTTGTATAGGG + Intronic
1042083179 8:65078254-65078276 CAGCAAAGAGCAGAAGTGAAAGG + Intergenic
1042613511 8:70623984-70624006 CAGAAAACTAAAGTAGTGCAAGG - Intronic
1045664320 8:104468926-104468948 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1046981771 8:120344246-120344268 GAGAAAACTGAAGTAGTGTAAGG - Intronic
1047276649 8:123410761-123410783 CAGCAAACAGCAGTGGTGGACGG - Intronic
1047289579 8:123517666-123517688 GAGCAAACTCCATGAGTGTAGGG - Intronic
1048142001 8:131803839-131803861 CAGAAAAGTGCAGTACTTTATGG + Intergenic
1048631490 8:136247645-136247667 CAGCAAACAGCAGTGGTGAATGG - Intergenic
1050175145 9:2862369-2862391 CAGCTTACTGAATTAGTGTAAGG + Intergenic
1050536087 9:6631957-6631979 CAGGAAGCTGCAGTAGTGGGAGG + Intronic
1050985374 9:12076145-12076167 CAACATAATGCAGAAGTGTATGG + Intergenic
1051699196 9:19801422-19801444 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1051970178 9:22878077-22878099 CAGCCAACAGCAGTGGTGGACGG + Intergenic
1056705015 9:88944283-88944305 CAGCAAACAGCAGTGGTGGTTGG + Intergenic
1057816742 9:98301452-98301474 CAGCATCCTGCTGTAGTATAAGG + Intronic
1060573298 9:124664272-124664294 AAGCAAACAGCGGAAGTGTAAGG + Intronic
1061928856 9:133821902-133821924 CAGAAAACAGCAGGAGTGAAAGG - Intronic
1203495320 Un_GL000224v1:145850-145872 CAGAAAACAACAGTAGTGTTTGG - Intergenic
1203507945 Un_KI270741v1:87773-87795 CAGAAAACAACAGTAGTGTTTGG - Intergenic
1187424642 X:19166058-19166080 CAGCAAACTGCACCAGTGCTAGG - Intergenic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1191868917 X:65728866-65728888 AAGCAAACTGCAGGACAGTATGG - Intronic
1192853931 X:74987161-74987183 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1192960997 X:76130737-76130759 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1193010473 X:76669818-76669840 TAGCAAACTGCAGTACTGGAGGG - Intergenic
1193040362 X:76998243-76998265 CAGCAAACTCCAGCAGAATAGGG - Intergenic
1193172388 X:78350375-78350397 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1193295496 X:79827570-79827592 CTGCAAACAGCAGTGGTGGAAGG + Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1195584602 X:106551389-106551411 CAGCAAACAGCAGTGGTGGTCGG - Intergenic
1195603813 X:106778729-106778751 CAGCAAACTACAGAAATGTGTGG - Intronic
1195949294 X:110250370-110250392 CAGCCAACTCCAGAAGTCTAAGG + Intronic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1199541739 X:148965501-148965523 CAGGGAACTGCAGTAGTATCTGG - Intronic
1199911226 X:152289077-152289099 CAGCAAGCAGAAGTACTGTAGGG - Intronic
1201421473 Y:13804542-13804564 CAGCAAACAGCAGTAGTGGAGGG - Intergenic