ID: 988807746

View in Genome Browser
Species Human (GRCh38)
Location 5:34756142-34756164
Sequence ACATATGGGCTAGGGTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 186}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988807736_988807746 -6 Left 988807736 5:34756125-34756147 CCCTGGCTTAAGGCCCTACATAT 0: 1
1: 0
2: 1
3: 6
4: 76
Right 988807746 5:34756142-34756164 ACATATGGGCTAGGGTTGGGAGG 0: 1
1: 0
2: 1
3: 9
4: 186
988807735_988807746 -3 Left 988807735 5:34756122-34756144 CCTCCCTGGCTTAAGGCCCTACA 0: 1
1: 0
2: 0
3: 17
4: 106
Right 988807746 5:34756142-34756164 ACATATGGGCTAGGGTTGGGAGG 0: 1
1: 0
2: 1
3: 9
4: 186
988807737_988807746 -7 Left 988807737 5:34756126-34756148 CCTGGCTTAAGGCCCTACATATG 0: 1
1: 0
2: 1
3: 0
4: 58
Right 988807746 5:34756142-34756164 ACATATGGGCTAGGGTTGGGAGG 0: 1
1: 0
2: 1
3: 9
4: 186
988807734_988807746 -2 Left 988807734 5:34756121-34756143 CCCTCCCTGGCTTAAGGCCCTAC 0: 1
1: 0
2: 5
3: 11
4: 177
Right 988807746 5:34756142-34756164 ACATATGGGCTAGGGTTGGGAGG 0: 1
1: 0
2: 1
3: 9
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988807746 Original CRISPR ACATATGGGCTAGGGTTGGG AGG Intronic
903290651 1:22312038-22312060 GCATATGAGCTAGGCTTGGAAGG + Intergenic
904611579 1:31728743-31728765 ACTTCTGGGCCTGGGTTGGGGGG - Intronic
904812222 1:33170844-33170866 TCATATCTCCTAGGGTTGGGAGG + Intronic
905395529 1:37664074-37664096 CCAGGTGGGCTAGGGCTGGGAGG - Intergenic
908190604 1:61699614-61699636 ACATTTGAGCTAGGGTTTGAAGG - Intronic
915293173 1:154900009-154900031 CCAGATTGGCTAGGGTGGGGAGG - Intergenic
918004247 1:180526795-180526817 AAATATGGCTTCGGGTTGGGAGG - Intergenic
918478323 1:184950119-184950141 TCATTTGGGTTGGGGTTGGGTGG - Intronic
919757162 1:201073450-201073472 ACAGGTGGGGTAGGGTGGGGAGG - Intronic
921589869 1:216990940-216990962 GTATATGGGGTGGGGTTGGGGGG - Intronic
924936236 1:248773865-248773887 ACGAGTGGGCCAGGGTTGGGGGG - Intergenic
1065826285 10:29574756-29574778 CCATGTGGGCCAGGGCTGGGAGG - Intronic
1065951087 10:30651862-30651884 CCATGTGGGCCAGGGCTGGGAGG + Intergenic
1067331586 10:45326918-45326940 ACACATGGACACGGGTTGGGGGG - Intergenic
1068972677 10:62975971-62975993 AAATAGGGAATAGGGTTGGGGGG - Intergenic
1069290358 10:66771587-66771609 ACATATGGGCTGGGGTTGGATGG + Intronic
1070789844 10:79182438-79182460 AGGTATGGGCTGGGTTTGGGGGG + Intronic
1071573023 10:86708323-86708345 ACACATGGGCTGGGGTGGAGCGG + Intronic
1072299782 10:94048386-94048408 TCATAGTGGCAAGGGTTGGGGGG - Intronic
1072424543 10:95318807-95318829 ACAGATGGGGTGGGGTGGGGGGG + Intronic
1074737588 10:116452526-116452548 ACATCTGGGCTTGTGATGGGAGG - Intronic
1077610594 11:3641449-3641471 ACATTTGGGGTAGGGGTGGTGGG + Intronic
1078394882 11:10972214-10972236 ACAGAAGGCCTAGGTTTGGGAGG + Intergenic
1079789223 11:24714602-24714624 ACGTATGGGTTAGGGGTTGGGGG - Intronic
1079806266 11:24933951-24933973 TCTTAAGGGCAAGGGTTGGGGGG + Intronic
1085693734 11:78686537-78686559 ATAGATGGGGTGGGGTTGGGGGG + Intronic
1088583223 11:111335079-111335101 TCATCTGGGTTTGGGTTGGGAGG + Intergenic
1090534667 11:127627394-127627416 ACATATGTGTGAGGGTGGGGTGG + Intergenic
1090813955 11:130273900-130273922 ATAGATGGGCCGGGGTTGGGCGG - Intronic
1091033099 11:132209016-132209038 ACGTATGGGTTGGTGTTGGGGGG + Intronic
1092870835 12:12804493-12804515 ACAGAGGGGCTGGGGTTGGAGGG - Intronic
1097295010 12:57953109-57953131 AGATTCGGGCAAGGGTTGGGAGG + Intronic
1099187178 12:79528425-79528447 AGATATGGGATGGGGTGGGGGGG - Intergenic
1102016727 12:109652991-109653013 ACTTAGGGGCTGGTGTTGGGGGG + Intergenic
1102100934 12:110278541-110278563 ACTTATGGGCTAGGGATGGTGGG + Intergenic
1102770185 12:115469385-115469407 GAACATGGACTAGGGTTGGGTGG + Intergenic
1105810587 13:23991790-23991812 GCAGGTGGGCTGGGGTTGGGAGG + Intronic
1110671300 13:78182080-78182102 AGATATGTGTTAGGGTAGGGAGG + Intergenic
1112409145 13:99146969-99146991 AGGTATTGGCTAGGGCTGGGAGG + Intergenic
1113934917 13:113988903-113988925 ACAGATGGGCGAGTGATGGGTGG - Intronic
1114646878 14:24260865-24260887 ACATGTGGGCAAGCATTGGGTGG - Intronic
1116934400 14:50724221-50724243 ATATATGGTCTAGGTTGGGGTGG + Intronic
1116954383 14:50908954-50908976 ACCTGTGGGGTAGGGGTGGGTGG + Exonic
1117395430 14:55304792-55304814 AAAAATGGGCTAGGGTGGGTTGG - Intronic
1119974600 14:79011392-79011414 AGGTATGGGGTGGGGTTGGGGGG - Intronic
1121175320 14:91886775-91886797 TCTTATCGGGTAGGGTTGGGGGG - Intronic
1121237587 14:92403833-92403855 GCATATGTGCCAGGGTGGGGGGG - Intronic
1125063969 15:35459473-35459495 ACATATGAATTTGGGTTGGGGGG + Intronic
1125672690 15:41485312-41485334 CCACTTGGGCTGGGGTTGGGAGG + Intergenic
1126450647 15:48804852-48804874 ATATATGAGCCAGTGTTGGGTGG - Intronic
1128285046 15:66429691-66429713 ACAGATGGGCTAGCCTGGGGTGG + Intronic
1130260343 15:82349167-82349189 CCAGAGGGGCTGGGGTTGGGGGG + Intronic
1130268387 15:82430266-82430288 CCAGAGGGGCTGGGGTTGGGGGG - Intronic
1130270994 15:82446926-82446948 ACAAATTGGGTAGGGTTAGGGGG - Intergenic
1130280890 15:82519840-82519862 CCAGAGGGGCTGGGGTTGGGGGG - Intergenic
1130463333 15:84174249-84174271 ACAAATTGGGTAGGGTTAGGGGG - Intronic
1130472260 15:84236021-84236043 CCAGAGGGGCTGGGGTTGGGGGG - Intronic
1130474185 15:84248632-84248654 ACAAATTGGGTAGGGTTAGGGGG - Intergenic
1130479753 15:84350592-84350614 CCAGAGGGGCTGGGGTTGGGGGG - Intergenic
1130481599 15:84362700-84362722 ACAAATTGGGTAGGGTTAGGGGG - Intergenic
1130489339 15:84420539-84420561 ACAAATTGGGTAGGGTTAGGGGG + Intergenic
1130492017 15:84437537-84437559 CCAGAGGGGCTGGGGTTGGGGGG + Intergenic
1130500932 15:84499301-84499323 ACAAATTGGGTAGGGTTAGGGGG + Intergenic
1130503633 15:84516577-84516599 CCAGAGGGGCTGGGGTTGGGGGG + Intergenic
1130508438 15:84569392-84569414 ACAAATTGGGTAGGGTTAGGGGG + Intergenic
1131098331 15:89669816-89669838 ACAGATGGGGTGGGGGTGGGGGG + Intronic
1132363015 15:101233626-101233648 CCCTATGTGCTGGGGTTGGGGGG + Intronic
1134071206 16:11260962-11260984 ACTTATGGGATGGGGTGGGGTGG - Intronic
1135113812 16:19709760-19709782 ACAGATGGGCGAGGGCTGGGAGG - Intronic
1135532647 16:23267687-23267709 AGATGTGACCTAGGGTTGGGAGG - Intergenic
1141352055 16:83307056-83307078 ACATATAAGCTACAGTTGGGTGG + Intronic
1143287155 17:5798657-5798679 ACATGTGGGCTAAGGTGGGGAGG + Intronic
1143462594 17:7113874-7113896 ACATGTGTTCTTGGGTTGGGAGG + Intronic
1146767952 17:35540888-35540910 AAATATGGGGTAGGGTGGGGTGG - Intergenic
1147871617 17:43591696-43591718 AGATATAGCCTAGGGCTGGGGGG + Intergenic
1148999369 17:51741305-51741327 ACATTTGGGATAGGGCTAGGTGG + Intronic
1151330913 17:73407528-73407550 ACAGATGAGCTTGGGTTGGAGGG - Intronic
1151530421 17:74700809-74700831 ACATATGGATTGGGGTGGGGGGG - Intronic
1151573242 17:74937721-74937743 ACATCTGCACTAGGTTTGGGGGG + Intronic
1152069955 17:78129507-78129529 CCAAATGGGCTTGGGGTGGGGGG - Intronic
1153384509 18:4477313-4477335 ACAGATGGGTTTGGATTGGGAGG + Intergenic
1156067449 18:33161566-33161588 TCCTATGGGCAAGGGTTGGCAGG + Intronic
1162928623 19:13944046-13944068 ACATATTGGCTAGCTCTGGGGGG + Intronic
1163811750 19:19436879-19436901 ACACATGGGCCAGAGTTGGCAGG + Intronic
1165389382 19:35529568-35529590 ACATATTGGCTCGGGTTGGAGGG + Intergenic
1165722738 19:38091047-38091069 ACATATGGGCAACTGCTGGGTGG + Intronic
1168443559 19:56392367-56392389 ACAAATGGGATAGAGTTGGAAGG + Intronic
927611905 2:24549368-24549390 ACATCTGGGCTTGTGATGGGAGG + Intronic
934521385 2:95022307-95022329 ACATACAGGCTAGGAATGGGAGG - Intergenic
934584158 2:95474979-95475001 ACATATGGGCACAGGTTGAGAGG + Intergenic
934595294 2:95601735-95601757 ACATATGGGCACAGGTTGAGAGG - Intergenic
935848738 2:107195883-107195905 ATCTCTGGGCCAGGGTTGGGAGG + Intergenic
937343603 2:121108498-121108520 ATATATAGGCTTGGGCTGGGAGG + Intergenic
942555928 2:177172300-177172322 ACATGGGGGCTGGGGTGGGGTGG - Intergenic
944667185 2:201967981-201968003 ACATATGGGTGGGGGTTGGGTGG - Intergenic
945394407 2:209302094-209302116 ACTTGTGGGTTAAGGTTGGGGGG - Intergenic
946337574 2:219048859-219048881 AGATCTAGGATAGGGTTGGGTGG - Intergenic
949007519 2:241658195-241658217 GCATCTGGGCTAGAGGTGGGAGG + Intronic
1170343446 20:15355392-15355414 ACATACAGGATAAGGTTGGGTGG + Intronic
1170680327 20:18520432-18520454 ACTTGTGGGTTAAGGTTGGGGGG + Intronic
1170872001 20:20214522-20214544 ACAGAAGGGCTTGGGGTGGGGGG - Intronic
1172149659 20:32780791-32780813 AGAGCTGGGCTGGGGTTGGGAGG + Intronic
1172526469 20:35602880-35602902 GCCTATGGGTTGGGGTTGGGGGG - Intergenic
1174503737 20:51003778-51003800 ACATAGGGGCTGGGGTGGGCGGG + Exonic
1175246787 20:57586946-57586968 ACACACGGGCAAGGATTGGGTGG + Intergenic
1175682964 20:61004627-61004649 AGGCATGGGCTAGGGTTGGAAGG + Intergenic
1177802645 21:25842930-25842952 ACAGAAGGGCTTGGGTTTGGGGG + Intergenic
1181035150 22:20166351-20166373 ATATCTGGGCTAGTGTTGGGGGG + Intergenic
1183018236 22:35007320-35007342 ACAGAAGGGCTTGGGTTGAGAGG - Intergenic
1183105720 22:35613783-35613805 AAATATGGGGTGGGGTGGGGTGG - Intronic
949210993 3:1501056-1501078 ACATATGGGGTGAGGTTGGCGGG + Intergenic
949602110 3:5611304-5611326 GCATATGGGGTAGGGGTTGGAGG + Intergenic
949907170 3:8867403-8867425 CCATATGTGTTAGGCTTGGGAGG - Intronic
949963154 3:9331509-9331531 ACATATGGGGCTGGGGTGGGTGG - Intronic
950575185 3:13827986-13828008 AGATAAGGACTGGGGTTGGGTGG - Intronic
951004194 3:17598009-17598031 AGTGATGGGCTGGGGTTGGGGGG - Intronic
951411375 3:22371805-22371827 ACATTTAGGGTGGGGTTGGGAGG - Intronic
954076503 3:48185784-48185806 ACACATGAGCTATGGGTGGGTGG - Intronic
954143299 3:48621371-48621393 ACCCATGGGGCAGGGTTGGGTGG + Intronic
956574478 3:70736655-70736677 ACATGCGTGCTAGGGTGGGGTGG - Intergenic
957558074 3:81785627-81785649 AGATATGGGTTTGGGTTGGAAGG + Intergenic
958871779 3:99567972-99567994 ACATATGGGTGTGGGGTGGGGGG - Intergenic
961324968 3:126104471-126104493 ACATGGGGACTAGGGTTAGGAGG + Intronic
962341557 3:134589599-134589621 ACATATTGGCAAGGGTGTGGAGG + Intergenic
965894475 3:173558401-173558423 ATATATAGGATGGGGTTGGGGGG - Intronic
966392019 3:179462918-179462940 ACAAATGAGGTTGGGTTGGGTGG - Intergenic
966601068 3:181775600-181775622 AAATATGGGCTTGGGTGTGGTGG - Intergenic
966634468 3:182116556-182116578 ACATGTGGTGTAGGGGTGGGAGG - Intergenic
967195642 3:187023176-187023198 ACATTTGAGCAAGGGTTGGAAGG - Intronic
968814414 4:2814630-2814652 ACACATGGGCCAGCGTTGGGCGG - Intronic
969525551 4:7702228-7702250 ACAGATGGGCAAGGGTGGGAGGG + Intronic
970716378 4:18930506-18930528 CCAGATGGCCTGGGGTTGGGTGG + Intergenic
972183805 4:36502817-36502839 ACATTTGGGCTGGGATTGGCTGG + Intergenic
972412736 4:38809353-38809375 AGGTATGGGATAGGGGTGGGCGG - Intronic
974354201 4:60791025-60791047 AGATATGGGGGAGGGCTGGGCGG - Intergenic
975641617 4:76506179-76506201 ACACATGGACACGGGTTGGGGGG + Intronic
980664981 4:135921476-135921498 ATATATGGACTAGGGTATGGTGG - Intergenic
980694535 4:136337780-136337802 ACAGTTGGCCCAGGGTTGGGTGG - Intergenic
982132415 4:152242448-152242470 ACGTATGGGTTGGGGGTGGGGGG + Intergenic
988807746 5:34756142-34756164 ACATATGGGCTAGGGTTGGGAGG + Intronic
990783388 5:59392629-59392651 AAATATAGGCCAGGGTTGGCAGG - Intronic
991174751 5:63674248-63674270 ACATGTGGTCTAGGTTAGGGAGG + Intergenic
992299601 5:75364596-75364618 ACAGATGGGGTGGGGTTGGGAGG + Intergenic
993776505 5:92005377-92005399 AAAAATGAGCCAGGGTTGGGAGG + Intergenic
995468444 5:112475010-112475032 AAATGGGGGCTGGGGTTGGGGGG + Intergenic
996965609 5:129304479-129304501 CCCTATTGGCTAGGGTTGGATGG + Intergenic
997756883 5:136407908-136407930 ACATTTTGGCTAGGGATGTGGGG - Intergenic
997829132 5:137133942-137133964 GCAGATGGGCTGGGGGTGGGGGG + Intronic
998486332 5:142505686-142505708 ATATTTGGGCCAGGGTGGGGTGG - Intergenic
999230272 5:150057595-150057617 ACATAGGAGAGAGGGTTGGGGGG + Intronic
1001387129 5:171349049-171349071 ATATATGGGCCAGGGTGCGGTGG - Intergenic
1002058726 5:176613636-176613658 CCACATGGGCTGGGGTGGGGAGG - Intergenic
1003381019 6:5624800-5624822 AGAAATGGGGTAGGGTGGGGCGG + Intronic
1004135125 6:12958488-12958510 ACATAAGGGATAGGCTTGGTGGG + Intronic
1004451704 6:15753763-15753785 ACTTATGGGATAGGGTGGGTAGG + Intergenic
1005190528 6:23216575-23216597 ACATATGGATTTGGGGTGGGGGG + Intergenic
1006706522 6:36025619-36025641 ACATGAGGGATGGGGTTGGGGGG - Intergenic
1007433811 6:41793585-41793607 AGTTATGGGGCAGGGTTGGGGGG - Exonic
1010180713 6:73084048-73084070 ACATATGGGCTAGGTAGGTGGGG - Intronic
1011463368 6:87629699-87629721 TCAAAAGGGGTAGGGTTGGGAGG - Intronic
1011570606 6:88730363-88730385 ACCTATTGGCTAGGGTTAGATGG - Intronic
1014555958 6:122842700-122842722 ACTTGTGGGTTAAGGTTGGGGGG - Intergenic
1016907737 6:149168489-149168511 ATAAATGGGCTGGGCTTGGGTGG - Intergenic
1017691981 6:156976060-156976082 ACATAAGCGCAAGGGCTGGGAGG + Intronic
1023558032 7:41443606-41443628 ACATAGGGGTTAGGGGTGGAAGG + Intergenic
1023698779 7:42873451-42873473 ACTTGTGGGTTAAGGTTGGGGGG + Intergenic
1024516350 7:50262322-50262344 ATCTATGGGGTAGGGTTAGGTGG - Intergenic
1026334790 7:69384365-69384387 ACTTCTGGGGTAGAGTTGGGAGG - Intergenic
1027351605 7:77317329-77317351 ACACTTGGACAAGGGTTGGGGGG + Intronic
1027688726 7:81313071-81313093 ACACATGGGCTAGGGCAGAGGGG + Intergenic
1028823630 7:95243569-95243591 ACATATGGCTTGGGGTTTGGGGG + Intronic
1029430820 7:100528849-100528871 ACATATAGGCTCGGGTGTGGTGG - Intergenic
1030479189 7:110080980-110081002 CCATAGGGGTTAAGGTTGGGTGG + Intergenic
1034301318 7:150017684-150017706 ACTGGTGGGCCAGGGTTGGGAGG - Intergenic
1034804733 7:154079614-154079636 ACTGGTGGGCCAGGGTTGGGAGG + Intronic
1036792741 8:11732973-11732995 ACATGTGGGTTAGGGTTGCCAGG + Intronic
1037458922 8:19089648-19089670 ACATTTCGGCTAGTGATGGGTGG + Intergenic
1038085518 8:24192419-24192441 AAAGATGAGCTAAGGTTGGGGGG + Intergenic
1038611826 8:29065836-29065858 ACACATGGAGAAGGGTTGGGTGG - Intergenic
1042826995 8:72989615-72989637 AAATATGGACAAGGGTTGTGAGG + Intergenic
1047909649 8:129514055-129514077 TCATATTGGCTAGGTTGGGGGGG - Intergenic
1049797850 8:144504721-144504743 GCACATGGGCTGGGGGTGGGGGG - Intronic
1050491987 9:6197853-6197875 ACATAAGGGCTCGGGGTAGGTGG + Intergenic
1054807381 9:69407586-69407608 ACTTGTGGGTTAAGGTTGGGGGG + Intergenic
1059424203 9:114210658-114210680 AGATACGGGCTCAGGTTGGGAGG - Intronic
1061202136 9:129143964-129143986 ACACAAGGGTTGGGGTTGGGAGG - Intronic
1061237991 9:129353052-129353074 ACACATGAGCTGGGGTGGGGCGG + Intergenic
1062218836 9:135403597-135403619 GCCTGTGGGCGAGGGTTGGGAGG - Intergenic
1189012779 X:37063249-37063271 ATATATGGGGTGGGGTGGGGTGG - Intergenic
1192203696 X:69082668-69082690 ACACAAGGGCAAGGGTGGGGAGG - Intergenic
1194751916 X:97694509-97694531 ACATATTAGTTTGGGTTGGGGGG - Intergenic
1195297439 X:103492970-103492992 ACATGTGGGATAGTGTTAGGAGG + Intergenic
1198119825 X:133580915-133580937 CCATATGGGCAGAGGTTGGGAGG - Intronic
1198742373 X:139854864-139854886 ACATATTGGCTAAGGTTGAAAGG + Intronic
1199955646 X:152740421-152740443 GCTTCTGGGCTAGGGTTGAGAGG - Intergenic
1201771563 Y:17621430-17621452 CCATCTGGGCTGGGGTTGTGGGG - Intergenic
1201829992 Y:18284556-18284578 CCATCTGGGCTGGGGTTGTGGGG + Intergenic