ID: 988818202

View in Genome Browser
Species Human (GRCh38)
Location 5:34854985-34855007
Sequence AGGGTTGTAAAGAAGGAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 255}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988818202 Original CRISPR AGGGTTGTAAAGAAGGAGTA GGG Intronic
901928808 1:12583816-12583838 ATGGTTGGATAGATGGAGTAGGG - Intronic
902091131 1:13904129-13904151 AGGGATCCAAAGAAGGACTAGGG + Intergenic
904396130 1:30223805-30223827 AGGGATGAAAACAAGGAGAATGG - Intergenic
907822056 1:57979826-57979848 AGGGATCTAAAGAAGGAATTAGG - Intronic
907926157 1:58956883-58956905 AGGGTGGTCAAGAAACAGTATGG - Intergenic
908833107 1:68200918-68200940 AGGGTCGAAAAGAGGGAGAAAGG + Intronic
908855555 1:68423080-68423102 AGAGTAGTAAAGAAGGAGTATGG - Intergenic
908855559 1:68423116-68423138 ACAGTAGTAAAGAAGGAGTATGG - Intergenic
910898639 1:92095369-92095391 AGGGTTGGTCAGAAGGAGCAAGG - Intronic
911707747 1:101033988-101034010 AGGGTAGAAAAGGAGGAGGAGGG - Intergenic
912150158 1:106849059-106849081 AGGGGTGAGAAGAAGGACTAAGG - Intergenic
912427197 1:109604850-109604872 AGGGTTGTACAGGAGTATTATGG - Exonic
915482975 1:156199792-156199814 AGGGATGTGAAGAAGGAGGGTGG - Intronic
915701962 1:157804742-157804764 AGGTTTGTAAAGAAGCTGTGTGG - Intronic
916286620 1:163112417-163112439 AGAGTGGTAAAGAAGGAGTTTGG + Intronic
918302416 1:183216345-183216367 AGGGTTACAAAGGAGGAGTGGGG - Intronic
920262914 1:204701945-204701967 AGGGTTGTAACGAAGGGAGATGG + Intergenic
920748918 1:208655655-208655677 ATGGGTGTGAAGAAGGAGAATGG - Intergenic
921650792 1:217675152-217675174 AGGTTTGTAGAGAAGGAGGATGG + Intronic
923031657 1:230253819-230253841 AGGCTGGGAAGGAAGGAGTAGGG - Intronic
923832121 1:237569914-237569936 AGAGTTGTAAAGATGGAGGGTGG + Intronic
924298196 1:242610517-242610539 AGGGTTGTAATGAAGGTTCAAGG - Intergenic
1064818119 10:19290429-19290451 AGGGTTGTAATCAAGGTATATGG + Intronic
1064957756 10:20930265-20930287 ATGTTTGTAATGAGGGAGTAGGG - Intronic
1066063522 10:31745187-31745209 AGGCTTGAAGAGAAGGAGCAAGG - Intergenic
1067228694 10:44392006-44392028 TGGGTTGTAAAGGAGGAGCTGGG + Intergenic
1067358202 10:45550817-45550839 TGGGTTGTAAAGAAGGGAAAGGG - Intronic
1068224258 10:54086272-54086294 ATGGTTGTAAAAAAGGAGCCTGG - Intronic
1070363624 10:75714822-75714844 AGGGAGGGAAAGAAGGAGGAAGG - Intronic
1076712165 10:132343474-132343496 AGCTTTTTAAAGAAGGAGTTTGG + Intronic
1078176436 11:8974960-8974982 TGGGTTGGGAAGAGGGAGTATGG - Intergenic
1079215697 11:18509148-18509170 AGTGTTGTAGATAAGGATTAAGG - Intronic
1080559986 11:33454239-33454261 ATGTTTGTAAAGTAGGAATAGGG - Intergenic
1081676360 11:44972265-44972287 AGGGTTGTGAAGGAGAAGGAGGG - Intergenic
1081999010 11:47382761-47382783 CTGGTTGTAAGCAAGGAGTATGG + Intergenic
1082631355 11:55545915-55545937 AAGATTGTAAAGATGGAGTAAGG - Intergenic
1084588435 11:70077036-70077058 AGGGTTGGAGAGAAGGGGTGGGG - Intergenic
1086410403 11:86539117-86539139 GGGGTTGTTAATAAGGAGGAAGG + Intronic
1086452162 11:86927679-86927701 AGGGTAGTTCAGAAGGAGAAAGG - Intronic
1086968821 11:93058359-93058381 AGGGTTTTAAAGAAAAAGTTGGG + Intergenic
1088187148 11:107183432-107183454 AGGCATGTAAAGAGGTAGTATGG + Intergenic
1090299851 11:125626042-125626064 AGGTTTCTAAAGAAGGAGTTCGG + Intronic
1090668292 11:128929689-128929711 TGAGTTGTAAAGGAGGAGGAGGG - Intergenic
1091081578 11:132673949-132673971 AGGGTAGTACAGAAGTAGGAAGG - Intronic
1093396092 12:18684353-18684375 AGGGTTGAAAAGAAAAAGTTTGG - Intronic
1096093219 12:48916800-48916822 AGGGCTAGAAAGAATGAGTAAGG - Intronic
1096513939 12:52146236-52146258 TGGGTTGTGAGGATGGAGTAGGG + Intergenic
1097930364 12:65177257-65177279 AGGGTTGGAGGGAAGGAGTAGGG + Intronic
1100087205 12:90926228-90926250 AGGGCTGAAAAGAAAGAATACGG + Intronic
1100370702 12:93966697-93966719 AGGGATGGAAAGAGGGAGGAAGG - Intergenic
1100711011 12:97256998-97257020 AGGGATGAAAAGAAGGATAATGG - Intergenic
1101816188 12:108147891-108147913 AGGGTAGGAGAGAAAGAGTATGG - Intronic
1104207881 12:126657494-126657516 AGGATGGAAAAGAAGGAGGAAGG + Intergenic
1106027752 13:25971480-25971502 AGGGTAGGAAAGAAGGAACAGGG - Intronic
1106783528 13:33085076-33085098 ATGGTTGGAAGGAGGGAGTAAGG + Intergenic
1108157155 13:47597168-47597190 AGGGATGTATAGTAGGAGAAAGG + Intergenic
1108299934 13:49063458-49063480 AGGATTGTAAACCAGGAGCATGG + Intronic
1108461930 13:50675604-50675626 AGGCTTGGAAGGATGGAGTAGGG - Intronic
1109652287 13:65344559-65344581 AGGCTTGGAAATAAAGAGTAAGG + Intergenic
1109848406 13:68028359-68028381 AGGCTTTTAAAGAAAGAATAAGG - Intergenic
1111119774 13:83831554-83831576 AGGGAAGAAAAGAAGGAGGAAGG + Intergenic
1112477673 13:99747252-99747274 AGGGTAGGAACGAAGGAGGAGGG - Intronic
1112743900 13:102505953-102505975 TGAATTGTAAAGAGGGAGTAGGG - Intergenic
1112863233 13:103861337-103861359 AGGATTGTTTTGAAGGAGTAAGG + Intergenic
1113166976 13:107453227-107453249 AGGGAAGTAAAGAAGGGATATGG - Intronic
1113387822 13:109866758-109866780 AGGGAGGGAAAGAAGGAGGAAGG + Intergenic
1114051912 14:18927351-18927373 AGGGTTTTAAAGGAAGAGTGGGG + Intergenic
1114110646 14:19474570-19474592 AGGGTTTTAAAGGAAGAGTGGGG - Intergenic
1115083800 14:29489426-29489448 AGGGTTGCAAAAAAGGAGCAAGG - Intergenic
1115339103 14:32273135-32273157 AGGGATCTAAAGAAGCAGTCTGG - Intergenic
1116234409 14:42259666-42259688 ACTGTTGTAGAGAAAGAGTAGGG + Intergenic
1116238398 14:42310643-42310665 AAGGTCCTCAAGAAGGAGTAAGG + Intergenic
1116982935 14:51190485-51190507 AGGGATGTAAAGAAGAGGTGAGG - Intergenic
1116996135 14:51327259-51327281 AGGATTGTCAAGAAGGAGGGAGG + Intergenic
1117863427 14:60118516-60118538 AAGGGTGAAAAGAGGGAGTAAGG - Exonic
1118101131 14:62604478-62604500 AGGGCTGTAAAGTAGGAGGCAGG - Intergenic
1119200889 14:72752109-72752131 AGTGTTGCAAGGAAGGAGTGAGG + Intronic
1120396331 14:83971439-83971461 TAGGTTGAAAAGAAGGAGGAAGG + Intergenic
1120764504 14:88316230-88316252 AGGGTTGAAGGGAGGGAGTAAGG - Intronic
1124618440 15:31259862-31259884 AGGGAGGGAAAGAAGGAGGAGGG + Intergenic
1126018031 15:44372299-44372321 ATGGCTATAGAGAAGGAGTATGG - Intronic
1126805342 15:52342611-52342633 AGGTTTTTAAAGAAGGTGTTTGG + Intronic
1126871769 15:52996853-52996875 AGGGTAGGAGAGAAGGAGCAAGG + Intergenic
1127451182 15:59118023-59118045 AGAGTTGTACAGAATGAGGAAGG + Intronic
1128780054 15:70353386-70353408 AGGAATTCAAAGAAGGAGTAAGG + Intergenic
1128901816 15:71429603-71429625 AGGGTTGAGAAGCAGGAGCAGGG + Intronic
1128985722 15:72219606-72219628 AGGATTGTAAAGAGGCAATATGG - Intronic
1135529086 16:23237251-23237273 AAGGTAGGAAAGAAGGAGAAGGG - Intergenic
1136369864 16:29829696-29829718 AGGGTGGAAAGGAAGGAGAAGGG - Intronic
1137449614 16:48559072-48559094 AGGGGTGGAAAGAAGAAGTAAGG + Intronic
1138141127 16:54569368-54569390 AGGGTTTCCAAGAAGGAGCAAGG - Intergenic
1138210407 16:55158363-55158385 AGTGTTGTGAGGAAGGAGTCAGG - Intergenic
1138423424 16:56914697-56914719 AGAGTTTTAAAGAAGGGGCAAGG + Exonic
1138458360 16:57133843-57133865 GGTGTTGTGAGGAAGGAGTAAGG + Intronic
1138600530 16:58051494-58051516 AGGGATGGAAAGAAGGAAGAAGG + Intergenic
1140509822 16:75498930-75498952 AGGGCTGTCAAGGAGGAGGAGGG + Intergenic
1140515618 16:75539138-75539160 AGGGCTGTCAAGGAGGAGGAGGG + Exonic
1140567527 16:76061490-76061512 AGGGTTGGAAAGCAGTAATAAGG - Intergenic
1145403315 17:22563856-22563878 AGGGGTTTAAAGAAAGAGTAGGG - Intergenic
1145723614 17:27096103-27096125 AGGGGTTTAAAGAAAGAGTGGGG + Intergenic
1145746016 17:27320349-27320371 AGGGTTGTTAAGAAGTACCAGGG - Intergenic
1145802872 17:27701380-27701402 AGAGTGCTCAAGAAGGAGTATGG + Intergenic
1146470722 17:33122173-33122195 AGGGTTGGAAATAGGCAGTAGGG - Intronic
1147470448 17:40653935-40653957 ATTGTTGTAAGGAAGGATTAGGG + Intergenic
1147830952 17:43297912-43297934 AGGGAGGTAAGGAAGGAGAAAGG - Intergenic
1149730720 17:58943560-58943582 AGGGTAGAAAGGAAGGAGGAGGG - Intronic
1151665638 17:75543824-75543846 AGGGTTGTCAAGGAGGTTTAGGG + Intronic
1153877021 18:9383032-9383054 ATGTTTGTAAATAAGGAGAAGGG + Intronic
1155630594 18:27887698-27887720 AGGGATGGAAGGAAGGAGGAAGG - Intergenic
1156084602 18:33383128-33383150 AGGGATCTAAAGAAGCAGTCTGG - Intronic
1157315227 18:46581385-46581407 AGAGTTGCCAATAAGGAGTAGGG + Intronic
1160549949 18:79688027-79688049 AGGAATGTAAAGAAGGAACAAGG - Intronic
1162859710 19:13497069-13497091 ATGGTTGTAGAGAAGCAGCATGG - Intronic
1163004349 19:14388389-14388411 AGGGTGGGAAAGGAGGCGTAAGG - Intronic
1163063114 19:14774345-14774367 AGGGTGGGAAAGGAGGCGTAAGG + Intronic
1163462325 19:17446613-17446635 AGGGTTGTGAGTAAGGAGGAAGG - Intronic
1163593099 19:18205147-18205169 AGGGTTTGAAAGCTGGAGTAGGG - Intergenic
1164771934 19:30816223-30816245 AGGGAGGAAAAGAAGGAGGAAGG - Intergenic
1164836011 19:31355428-31355450 AGGGAAGGAAGGAAGGAGTACGG + Intergenic
1167262831 19:48468758-48468780 ATGGTGATAAAGAAGGAGTTCGG + Intronic
926037581 2:9647256-9647278 TGGGTTTTAAAGAATGAATAAGG + Intergenic
926883760 2:17577998-17578020 ACGGTTGTAAAGAAGAAGTGAGG + Intronic
927729138 2:25454949-25454971 AGGGTGGTAAAGATGTAATAGGG + Intronic
929510470 2:42562443-42562465 AGGGCTGGGAAGAAGGAGTGAGG + Intronic
930532323 2:52605187-52605209 AGGGTTGTAGTTAAAGAGTATGG - Intergenic
934050872 2:88209756-88209778 AGGGTGGGAGAGAAGGAGAAGGG - Intergenic
936116856 2:109709602-109709624 AGGGTTGTAAAGATGAAACAAGG + Intergenic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
937627487 2:124059664-124059686 AGGGCTGTTAAGAAGGAGTTGGG + Intronic
937793374 2:125986814-125986836 ATAGTTGGAAAGAATGAGTAAGG - Intergenic
938751937 2:134340617-134340639 AGGTTTGTAAAGAAGGAGCCTGG - Intronic
939025894 2:137013689-137013711 TGGGTTTTAAAGAAGGATCAGGG - Intronic
939321769 2:140632358-140632380 AGGGATGTGAAGAAGAAATAGGG + Intronic
940430270 2:153581981-153582003 ATGGTTGAAAAGAAGGTATAAGG - Intergenic
940661805 2:156554414-156554436 AGGCTGGTAAAGGAAGAGTAAGG + Intronic
941511061 2:166410591-166410613 AGGGTTGTAAAAGAGGACAAAGG + Intronic
941518695 2:166511289-166511311 AGGAATCTAAAGAAGGAGTCTGG + Intergenic
941920558 2:170846665-170846687 AGTGTTGTAAAGACTGAGCAAGG + Intronic
942622192 2:177857598-177857620 AAGGCAGTAAAGAAGGAATAGGG + Intronic
944935197 2:204560696-204560718 CGGGTAGTAGGGAAGGAGTAAGG + Intronic
945712406 2:213315284-213315306 AGGGTGGTAAAGAGGGAGGTGGG - Intronic
946073108 2:217051233-217051255 ATGGTTCCAAAGTAGGAGTAGGG + Intergenic
947330706 2:229026368-229026390 TGGGGTTTAAAAAAGGAGTAAGG - Intronic
948570868 2:238916426-238916448 AGGGAGGGAAAGAAGGAGGAGGG + Intergenic
1169344704 20:4821188-4821210 AGGATTGAAAACAAGGTGTAGGG + Intronic
1173679206 20:44864769-44864791 AGGGTTGTAAAGCTGGAGTGAGG - Intergenic
1175492378 20:59387913-59387935 AGGGATGGAAAGAAGGGGTGTGG + Intergenic
1175689202 20:61053436-61053458 AGGGATGTCAGGAAGGAGGACGG + Intergenic
1176070985 20:63226382-63226404 AGGGTTGTTCAGCAGGAGTGGGG + Intergenic
1177348846 21:19908661-19908683 GGGGTGGTAAAAAGGGAGTAAGG + Intergenic
1179625245 21:42645597-42645619 AGCTTTGTACAGAAGGAGCAAGG + Intergenic
1180470386 22:15649727-15649749 AGGGTTTTAAAGGAAGAGTGGGG + Intergenic
1180566268 22:16668456-16668478 AGGGATGAAGAGAAGGATTATGG + Intergenic
1181676308 22:24455720-24455742 AGCTTTGTAAAGCAGGAGAATGG - Intergenic
1182370200 22:29805300-29805322 AGGGTTGTTAACAAGGAGGAAGG - Intronic
1183292213 22:37009860-37009882 AAGGTTGGAAAATAGGAGTAGGG - Intergenic
1183318294 22:37148857-37148879 AGGGTGGTAAAGCAGGAGCTCGG + Intronic
1185018296 22:48358441-48358463 AGGGTTTTCAAGTAGGAGTTTGG - Intergenic
950274146 3:11644034-11644056 AGTGTTGGAAAGAAAGAGAAAGG + Intronic
950805513 3:15599782-15599804 AGGGATGTAAAGAAGGAGTGAGG - Intronic
953018875 3:39101235-39101257 AGGGGTGAAATGAGGGAGTATGG - Intronic
956398789 3:68854089-68854111 AGAATTATAAAGCAGGAGTATGG + Intronic
956756342 3:72391517-72391539 TGGGTTTTACAGAAGAAGTATGG - Intronic
956872954 3:73436040-73436062 GGGGTTGGAAGGAAGGAGAAAGG - Intronic
957131377 3:76226415-76226437 AGGGTGGTGATGAAGGAATAAGG + Intronic
958696565 3:97535461-97535483 TGGGTTGTAGAGATGGAGAAGGG + Intronic
960201505 3:114842406-114842428 AAGTTTTTAAAGAAGGGGTAAGG - Intronic
960955644 3:123028452-123028474 AGAATTGTGAAGAACGAGTAGGG + Intronic
961034934 3:123635539-123635561 AGGGTTGTCAGGAGGGAGGAGGG - Intronic
961554099 3:127685782-127685804 AGGGATGGAAAGAGGGAGGAAGG - Intergenic
962649927 3:137478222-137478244 GGGGTTGTAAAGAAGGCAGATGG - Intergenic
962884132 3:139607912-139607934 GGGGTTGTCAAGACGGAGTTAGG - Intronic
963056364 3:141189303-141189325 TGGGTTGGTAGGAAGGAGTAGGG - Intergenic
964238730 3:154565944-154565966 AGTGTTGTAAATTTGGAGTAAGG + Intergenic
964821334 3:160773520-160773542 AGGGTAGAAAAGAAAGATTAGGG + Intronic
965083872 3:164069408-164069430 AGGGAAGTAAAGAAGAGGTAAGG + Intergenic
965375911 3:167923827-167923849 AGGGGTATAAAGAAGAACTAAGG - Intergenic
966751111 3:183323076-183323098 AGGGTGGGGAAGAAGGAGTGTGG - Intronic
967355392 3:188564224-188564246 AATGGTGGAAAGAAGGAGTATGG - Intronic
967570831 3:191026466-191026488 AAGGTAATAAAGCAGGAGTAGGG + Intergenic
969514785 4:7641015-7641037 AGGGTTGGAAAGAGGCAGCATGG + Intronic
970274485 4:14383376-14383398 AGGTTTGTAAAGCAGGAGTCGGG - Intergenic
970647012 4:18133921-18133943 AGGAGTGTCTAGAAGGAGTATGG + Intergenic
971604133 4:28635480-28635502 AGGGTTGAAAAGATGGAATTTGG + Intergenic
971785056 4:31090503-31090525 ATGGTTAGAAAGAATGAGTAAGG - Intronic
973785277 4:54326821-54326843 AGGATTGTAGGGAAGGAGAAGGG - Intergenic
973811041 4:54570505-54570527 AGGATGGTAAGGAAGGAGTGTGG + Intergenic
977238128 4:94533500-94533522 AGAGATGTAAAGAAGGTGAATGG + Intronic
977800486 4:101224349-101224371 TGGATTGGAAAGGAGGAGTAGGG - Intronic
979448010 4:120838135-120838157 GGGGTTGTAAAACTGGAGTATGG - Intronic
979513949 4:121585543-121585565 AGGCTTGTAAAGTAGGAGTGAGG + Intergenic
980418161 4:132520540-132520562 CTGGTAGTATAGAAGGAGTAGGG + Intergenic
981245953 4:142538183-142538205 ATGCTTACAAAGAAGGAGTATGG - Intronic
981676604 4:147350174-147350196 AGGAAAGTAAAGAAGAAGTAAGG + Intergenic
982415268 4:155123919-155123941 AGGCAGGTAAAGAAGGAGAAGGG - Intergenic
986704931 5:10447006-10447028 AGGGGTGTAAAGAGAGAGAAAGG + Intronic
987129085 5:14843776-14843798 AGGATGGAAAAGAAGCAGTAAGG + Intronic
988818202 5:34854985-34855007 AGGGTTGTAAAGAAGGAGTAGGG + Intronic
989175996 5:38526913-38526935 AGGGGGCTAAAGAAAGAGTATGG + Intronic
989264465 5:39456969-39456991 AGGGTTGTCCAGAAGGAAGAAGG + Intronic
989327041 5:40210332-40210354 AGATTTATAAAGAAGGATTAAGG - Intergenic
989788271 5:45358389-45358411 AGGATTGGGATGAAGGAGTAGGG - Intronic
990061079 5:51649667-51649689 AGGGTAATAAAGAAGAAGTAGGG - Intergenic
991392735 5:66165786-66165808 GGGATTTTAAAGAAGGAGAAAGG + Intronic
992052911 5:72956800-72956822 AGGGGTGGAAAGAATGAGGAAGG - Intronic
992402594 5:76425325-76425347 AGGGTAGTAAATAAAGAGGATGG - Intronic
994835329 5:104844379-104844401 AGGGTGGCAAACAAGGAGAATGG - Intergenic
995410387 5:111850703-111850725 AGGGTAGTAAAGGAAGAGAATGG - Intronic
995508852 5:112887754-112887776 AGAGCTGTAAAGAAGGAGTTAGG - Intronic
996240891 5:121199912-121199934 AAGTTTGTAATGAAGGATTAGGG + Intergenic
996793979 5:127324240-127324262 AAGGTTGAGAAGAATGAGTAGGG + Intronic
997146832 5:131443562-131443584 AGGTTTGTGCAGAAGGAGAAGGG - Intronic
997361004 5:133294897-133294919 AGGGTTGTCAAGAGAGGGTAAGG - Intronic
998400455 5:141846078-141846100 AGGGTTGTAAGGAAAGGGTAGGG + Intergenic
1000304603 5:159983936-159983958 AGGGTTCTCAAGGAGAAGTAAGG - Intergenic
1000354779 5:160384006-160384028 ACAGTTATAAAGAAGGAATATGG + Intergenic
1000721186 5:164709382-164709404 AGGGGTGAAATGAAGGTGTAGGG - Intergenic
1001884796 5:175279801-175279823 AGGCAGGTAAAGAAGGAGAAAGG - Intergenic
1002102353 5:176863772-176863794 AAGGGGGTAAAGAAGGAGGAGGG - Intronic
1003179921 6:3782631-3782653 TGGGTTGGAGAGAAGGAGCAGGG + Intergenic
1003733501 6:8852194-8852216 AGGGTGGTATAGAATGAGTTGGG - Intergenic
1003978684 6:11368800-11368822 AGGGATGTAAAGAATGAGTAGGG - Intronic
1004306436 6:14505858-14505880 TGGGCTGTAAAGAAGAAGTTAGG - Intergenic
1006756642 6:36421839-36421861 AGGGTTCTAAAAGAAGAGTAAGG - Intronic
1007263831 6:40582665-40582687 AGGGTTGTATAGAAGGTATGGGG - Intronic
1007275841 6:40673050-40673072 AGGGATGGAGAGAAGGAGAAAGG - Intergenic
1008471033 6:51885539-51885561 AGAGATGGAAAGAAGGAATAGGG + Intronic
1008930361 6:56932516-56932538 AGGGTGGGAGAGAAGGAGGAGGG + Intronic
1010673898 6:78719526-78719548 AGGGTTCTCAAGAAGAAGGAAGG + Intergenic
1011001765 6:82597712-82597734 AGGTTTTTAAAAATGGAGTAGGG + Intergenic
1011551216 6:88532690-88532712 AGGGAAGTAAAGAAGCAGGAGGG - Intergenic
1011593988 6:88998346-88998368 AGGGTTTTCAACAAGGAGTTTGG - Intergenic
1013592546 6:111631576-111631598 AGGGTTAGAAAGAAGGAGGCTGG + Intergenic
1013974335 6:116059885-116059907 GGGGTTGTAGAGAAGTAGAAAGG + Intronic
1016621239 6:146110926-146110948 AGGGTTTTAAAGAAGAAAGAAGG + Intronic
1017035371 6:150262428-150262450 AGGGTTATGAAGAAGGAGGGTGG - Intergenic
1021828350 7:24576375-24576397 ATGTATGTAAAGAAGGAATATGG - Intronic
1022210181 7:28200985-28201007 AGGATTCTAAAGAAGAAATATGG - Intergenic
1023600209 7:41875073-41875095 AGTGTGTTGAAGAAGGAGTAGGG + Intergenic
1023839929 7:44091067-44091089 AGGGTTGGAAGCCAGGAGTATGG + Intergenic
1024196046 7:47059916-47059938 AGGTTTGTAAGGGAGCAGTAAGG + Intergenic
1025980861 7:66404562-66404584 AGGGATGTAAAGAAAGACGATGG - Intronic
1026605910 7:71815747-71815769 AGGGAAGGAAAGAAGGAGGAAGG - Intronic
1027205748 7:76096933-76096955 AGGGATGTAAAGAAAGACGATGG - Intergenic
1029786618 7:102798210-102798232 AGGGAAGTAAATAAGGAGGAAGG + Intronic
1037131985 8:15417604-15417626 AACGTTGTAAAGAAGGAGTTAGG + Intronic
1040640771 8:49331998-49332020 AGAGTTGTAAATAGGGACTAGGG + Intergenic
1042079998 8:65041096-65041118 AGGGATGTAAAATAGGAGTAAGG + Intergenic
1042957610 8:74268386-74268408 AGGGTTGGAAACATGGAGCAAGG + Intronic
1045497804 8:102722883-102722905 GGGGTTGAAAAGAATGAGTCTGG - Intergenic
1045726362 8:105178477-105178499 GAGGTTGTATAGAAGGAGAAAGG - Intronic
1048454490 8:134565684-134565706 AGGCTCCTAAAGAAAGAGTAAGG + Intronic
1049039912 8:140104834-140104856 AGGGTTAGAAAGAGGAAGTAAGG - Intronic
1049758543 8:144321512-144321534 CTGGTTGTAAATAAGGAGTGGGG - Intronic
1049899895 9:149428-149450 AGGCTTTTACAGATGGAGTAGGG - Intronic
1052864766 9:33458232-33458254 AGGCTTGGGAAGAAGGAGAAGGG + Intergenic
1053486128 9:38457720-38457742 ATGGTTGTAATGAAGGCCTAGGG + Intergenic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054740651 9:68802885-68802907 AGGATTTTAAAGAAGGAGAGTGG + Intronic
1055577613 9:77675971-77675993 AGAGTGGCAGAGAAGGAGTAAGG + Intergenic
1055725687 9:79225991-79226013 AGGGAGGGAAAGAAGGATTATGG - Intergenic
1056182462 9:84098765-84098787 AGGGTTGAAATGAAGGATAATGG + Intergenic
1056656352 9:88512661-88512683 AGGGTTGAGGAGAAGGTGTAGGG + Intergenic
1059532845 9:115053010-115053032 TTGGTTCTAAAGAAGGAATATGG + Intronic
1060170257 9:121455542-121455564 AGGGTAGGAAAGAAGGAGAAGGG + Intergenic
1185734393 X:2485965-2485987 AGGGTTGGACGGAAGGAGGAGGG + Intronic
1188800381 X:34522530-34522552 AGTGTTTTAAAGAAAGAGGAAGG + Intergenic
1189011184 X:37047188-37047210 AGAGTTTTGGAGAAGGAGTAGGG - Intergenic
1190743901 X:53309421-53309443 AGAGTTCTAAAGAAAGAGAAGGG - Intronic
1192674331 X:73179743-73179765 AGGTGTGTATAGAAGGAGTGGGG + Intergenic
1192797963 X:74440159-74440181 AGGGTTTTAGAGAGGGAGTAGGG + Intronic
1194213681 X:91100839-91100861 AGGAATGAAAAGAAGGAGTAGGG + Intergenic
1194891179 X:99381789-99381811 AAGGTTGAAAAAAAGGTGTATGG + Intergenic
1195315417 X:103672688-103672710 AGGGTTGGATAGAAGCAGCAGGG + Intergenic
1195937621 X:110140532-110140554 AGGGTTGTAGAGTGGGAGGAAGG + Intronic
1197895471 X:131309009-131309031 TAGTTTGTAAAGAGGGAGTAAGG + Intronic
1201117899 Y:10848546-10848568 AGGATTGTAATGGAGGAGAATGG - Intergenic
1202386949 Y:24335471-24335493 AGGGAGGGAAAGAAGGAGCAAGG - Intergenic
1202483837 Y:25334657-25334679 AGGGAGGGAAAGAAGGAGCAAGG + Intergenic