ID: 988819231

View in Genome Browser
Species Human (GRCh38)
Location 5:34864059-34864081
Sequence GAGGAACTAATTACGCTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 93}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988819231_988819235 6 Left 988819231 5:34864059-34864081 CCTTTCAGCGTAATTAGTTCCTC 0: 1
1: 0
2: 1
3: 13
4: 93
Right 988819235 5:34864088-34864110 ACCATTCACAGGAACAGGCTTGG No data
988819231_988819237 7 Left 988819231 5:34864059-34864081 CCTTTCAGCGTAATTAGTTCCTC 0: 1
1: 0
2: 1
3: 13
4: 93
Right 988819237 5:34864089-34864111 CCATTCACAGGAACAGGCTTGGG 0: 1
1: 0
2: 0
3: 14
4: 161
988819231_988819234 1 Left 988819231 5:34864059-34864081 CCTTTCAGCGTAATTAGTTCCTC 0: 1
1: 0
2: 1
3: 13
4: 93
Right 988819234 5:34864083-34864105 CTTTTACCATTCACAGGAACAGG 0: 1
1: 0
2: 0
3: 11
4: 226
988819231_988819232 -5 Left 988819231 5:34864059-34864081 CCTTTCAGCGTAATTAGTTCCTC 0: 1
1: 0
2: 1
3: 13
4: 93
Right 988819232 5:34864077-34864099 TCCTCTCTTTTACCATTCACAGG 0: 1
1: 0
2: 1
3: 22
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988819231 Original CRISPR GAGGAACTAATTACGCTGAA AGG (reversed) Intronic
906822357 1:48943012-48943034 GAGGAAATAACTACGATAAAGGG - Intronic
910147610 1:84101029-84101051 AAGAAACTCATTACGCTGTAAGG + Intronic
911343914 1:96673922-96673944 GGGGAACTCATCACCCTGAAGGG - Intergenic
911660243 1:100493479-100493501 GAGGAACTTATTACCATCAAAGG - Intronic
912035950 1:105313835-105313857 TAGGTACTAATTACCCAGAAGGG - Intergenic
914991663 1:152504167-152504189 GAGGTACTAAATAGACTGAAAGG - Intergenic
915188363 1:154126399-154126421 GAGCAACTAACTACCGTGAATGG - Exonic
916769063 1:167890635-167890657 GAGGAACTCATCACCCTGAAGGG - Intronic
916865178 1:168848768-168848790 AAGGAACTAAATATACTGAAGGG - Intergenic
919251900 1:195066600-195066622 GAGGAACTCACTGCCCTGAAGGG + Intergenic
920584740 1:207146631-207146653 GAGCAACTAGTTTCCCTGAAAGG + Intergenic
920953569 1:210597407-210597429 GAGGAACCCATAACCCTGAAGGG - Intronic
1062804393 10:406495-406517 GAGGAAATTATGACACTGAAAGG + Intronic
1064521641 10:16209299-16209321 GGGGAACTCATTGCACTGAAGGG - Intergenic
1065921923 10:30400210-30400232 AAGGAACTCATTGCCCTGAAGGG + Intergenic
1070281129 10:75049703-75049725 GAGGAACTAATTCCGCCTTAAGG - Intronic
1073335151 10:102701788-102701810 GAGGAAATAATAATGATGAATGG + Intronic
1074839731 10:117338465-117338487 GAGTACATAATTAGGCTGAAGGG - Intronic
1078273582 11:9820820-9820842 AAGGAAAAAATTAGGCTGAAAGG + Intronic
1085984185 11:81765253-81765275 CATGAACTAATTACCCTCAAAGG + Intergenic
1087417068 11:97871160-97871182 GGGCAACTCATTACTCTGAAGGG - Intergenic
1087720900 11:101664685-101664707 GAGGAACTCACCACCCTGAAGGG - Intronic
1097504130 12:60443009-60443031 TAGGACCTAATTAAACTGAAGGG + Intergenic
1098060403 12:66554961-66554983 GAGGAACTCTCTACCCTGAAGGG + Intronic
1106258321 13:28041698-28041720 GACTAACTAATTAGGCTGATTGG + Intronic
1108255872 13:48610939-48610961 GGGGAACTCACTACCCTGAAGGG - Intergenic
1110726895 13:78836450-78836472 GAGCAACTAATAACAATGAAGGG - Intergenic
1114245135 14:20905707-20905729 GAGGAACTCATCACCCTGAAGGG + Intergenic
1114248148 14:20933898-20933920 GAGGACCTCATGACCCTGAAGGG + Intergenic
1114250973 14:20959978-20960000 GAGGAACTCATCATCCTGAAGGG + Intergenic
1115661095 14:35494835-35494857 GGGGAACTCATTGCCCTGAAGGG + Intergenic
1117763303 14:59055675-59055697 GAGGCACTAATTACTCTGATGGG - Intergenic
1120038900 14:79729886-79729908 GAGGCACTAATTGGGCTGACTGG + Intronic
1121287570 14:92748352-92748374 GAGAAACTGATTACTCAGAAAGG + Intronic
1202888728 14_KI270722v1_random:134762-134784 GAGGAATGACTTACGGTGAAAGG - Intergenic
1126486561 15:49187822-49187844 GAGGAGCTCACTACCCTGAAGGG - Intronic
1133941824 16:10315834-10315856 GAGGAACTGATTAGCGTGAAAGG + Intergenic
1138638211 16:58361354-58361376 GGGGAACTCATTGCCCTGAAGGG - Intronic
1138916635 16:61472126-61472148 GAGGAACTCATTGCCCTGAAAGG + Intergenic
1141127630 16:81412232-81412254 CTGGAACAGATTACGCTGAATGG - Intergenic
1141213651 16:82004284-82004306 GAGGATCTAGGTAGGCTGAAAGG + Intronic
1149180574 17:53931774-53931796 GAGGAACTAGCTACCTTGAAGGG - Intergenic
1155443499 18:25885609-25885631 GGGGAACTCATTACCCTGAAGGG + Intergenic
1157564314 18:48669249-48669271 AATGAACTAGTTACTCTGAAAGG + Intronic
929524951 2:42693316-42693338 GAGGAACTCACTACCCTGAAGGG - Intronic
930635521 2:53801311-53801333 GAGGAACTTATTATTCTGAAAGG - Intronic
931085893 2:58830511-58830533 GAGGAACTCATTGCCCTGAAGGG - Intergenic
945210307 2:207375650-207375672 GAGGAATTCATTGCCCTGAAGGG + Intergenic
947370201 2:229437939-229437961 GAGAAACTACCTAGGCTGAAGGG + Intronic
948366689 2:237459785-237459807 GAGGAATTCATTCCTCTGAAGGG + Intergenic
1172701103 20:36854245-36854267 AAGGAGCTAATTACCCTGGAAGG + Intronic
1177888844 21:26780688-26780710 GAGTAACAAATTACTCTAAAAGG + Intergenic
1179977674 21:44878844-44878866 GAGGAACTCACTTCGCTGGACGG + Intergenic
1183004929 22:34893388-34893410 GATGAACAAATTAGGATGAAGGG - Intergenic
950999220 3:17538615-17538637 GAGGAAAGAATTTTGCTGAAGGG - Intronic
960475382 3:118118125-118118147 TAGGAAGTAATTATGATGAATGG - Intergenic
962038700 3:131682713-131682735 GAGGAACTCACTAACCTGAAGGG - Intronic
962698933 3:137978515-137978537 GAGGAACTCACCACCCTGAAGGG - Intergenic
966452138 3:180074487-180074509 GAGGAACACATTGCCCTGAAAGG + Intergenic
967551140 3:190796965-190796987 GGGGATCTTATTACTCTGAAGGG + Intergenic
971764684 4:30815274-30815296 GAGGAAATAATTAGGCTGAGGGG + Intronic
973763310 4:54140336-54140358 GAGGAACTCACTGCCCTGAATGG + Intronic
973852862 4:54977999-54978021 GGGAAACTCATTACCCTGAAGGG + Intergenic
974414891 4:61594749-61594771 GAGGAACTCACTACCTTGAAGGG - Intronic
975222832 4:71833145-71833167 GAGGAAATAATTCAGCTGAGGGG + Intergenic
976009938 4:80475053-80475075 GAGGAAATAATGACTTTGAAGGG + Intronic
981116672 4:140998797-140998819 AAGGAACTAAGGAAGCTGAAAGG - Intronic
981735483 4:147945841-147945863 GTGGAACTTATTAAGCTTAAGGG + Intronic
983346725 4:166536159-166536181 GAGGAAATACTTAGGCAGAAAGG - Intergenic
984436569 4:179717721-179717743 GAGGAAATAATTCAGCTGAGGGG - Intergenic
984529626 4:180901117-180901139 GAGGAACTCACTGCCCTGAAGGG - Intergenic
988236843 5:28557004-28557026 GGGGAACTTATAACCCTGAAGGG - Intergenic
988819231 5:34864059-34864081 GAGGAACTAATTACGCTGAAAGG - Intronic
991293866 5:65060799-65060821 GAGGAGCTAAATAAGCAGAATGG + Intergenic
999849417 5:155522785-155522807 GGGGAACTCACTACCCTGAAGGG - Intergenic
1000399556 5:160811762-160811784 GGGGAACTCATTACTCTGAAAGG + Intronic
1006018501 6:31102623-31102645 GAGGAACTTGTTGCCCTGAAGGG - Intergenic
1006607402 6:35268134-35268156 TAGGTGCTAATTAGGCTGAAAGG + Intronic
1009568419 6:65346211-65346233 GAGGAACTAAGAAGGCTGACTGG - Intronic
1016045438 6:139476195-139476217 TAGGTACTACGTACGCTGAACGG + Intergenic
1016623735 6:146142473-146142495 GGGGAACTCATCACCCTGAAGGG - Intronic
1017398100 6:154027554-154027576 GAGGAACTTGTCACACTGAAGGG - Intronic
1017591295 6:155980607-155980629 GAGGGACTTATTACTCTCAAGGG - Intergenic
1018767846 6:166947735-166947757 GAGGCACCAATTAAGCTAAAAGG + Intronic
1020800100 7:12722281-12722303 GAGGAACACATTACTCAGAAAGG - Intergenic
1024955287 7:54912193-54912215 GAGAAAGTAATTAATCTGAAAGG - Intergenic
1028124039 7:87090990-87091012 GAGGAACTGATTCTGCTGCAAGG + Intergenic
1031323720 7:120365423-120365445 GAGGAACTAAGAAGGCTGTAAGG + Intronic
1032766772 7:135001472-135001494 GAGGAATTAACAAAGCTGAAAGG - Intronic
1041033305 8:53760615-53760637 GAGGAAATAATTCTGCTGAGGGG - Intronic
1047138275 8:122106628-122106650 GAGGAACTCACTGCCCTGAAGGG - Intergenic
1048632632 8:136260648-136260670 GAGGCACTAAAAAGGCTGAAGGG - Intergenic
1050145284 9:2560582-2560604 GGGGAACTCATCACCCTGAAGGG + Intergenic
1050177968 9:2888944-2888966 TAGGAACTAATTAAATTGAAGGG + Intergenic
1050423629 9:5492046-5492068 GAGGAACTAATTAAGGTGAATGG - Intergenic
1050835222 9:10069005-10069027 AAAGAACTAATTTTGCTGAAGGG - Intronic
1186475712 X:9855970-9855992 GAAGAATTAATTACTTTGAATGG + Intronic
1186691866 X:11985961-11985983 GGGGAACTCATCACCCTGAAGGG + Intergenic
1189755953 X:44271535-44271557 AAGGAACTGAGTACCCTGAAAGG + Intronic
1192045927 X:67674418-67674440 GAGGAACTCATCACCCTGAAGGG - Intronic
1192839102 X:74835842-74835864 GAGGAACTTGTCACCCTGAAGGG - Intronic
1193650389 X:84123756-84123778 GGGGAACTCATTGCCCTGAAAGG + Intronic
1193986743 X:88252186-88252208 GAGGAACTCACTACCCTGAAGGG - Intergenic
1195594435 X:106672708-106672730 GAGGAACTAGCTGCACTGAAGGG - Intronic
1195718702 X:107844404-107844426 GAGAAAATAATTACTCTGATAGG - Intronic
1198537644 X:137601898-137601920 GAGGAACTCATTGCCCTGAAGGG + Intergenic
1198702488 X:139413347-139413369 GAGGAAATCATCACTCTGAAGGG - Intergenic
1199036105 X:143052857-143052879 GAGAAACTCATTGCCCTGAAGGG - Intergenic