ID: 988819651

View in Genome Browser
Species Human (GRCh38)
Location 5:34868945-34868967
Sequence CGCACTCATTTCTGCAGTTT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 78}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988819651_988819653 6 Left 988819651 5:34868945-34868967 CCAAAACTGCAGAAATGAGTGCG 0: 1
1: 0
2: 0
3: 5
4: 78
Right 988819653 5:34868974-34868996 GCCAAAGCTTATGCCATGTCTGG 0: 1
1: 0
2: 0
3: 6
4: 95
988819651_988819657 22 Left 988819651 5:34868945-34868967 CCAAAACTGCAGAAATGAGTGCG 0: 1
1: 0
2: 0
3: 5
4: 78
Right 988819657 5:34868990-34869012 TGTCTGGAGAGGCCCAGCACAGG 0: 1
1: 0
2: 2
3: 27
4: 263
988819651_988819658 23 Left 988819651 5:34868945-34868967 CCAAAACTGCAGAAATGAGTGCG 0: 1
1: 0
2: 0
3: 5
4: 78
Right 988819658 5:34868991-34869013 GTCTGGAGAGGCCCAGCACAGGG 0: 1
1: 0
2: 5
3: 34
4: 226
988819651_988819659 24 Left 988819651 5:34868945-34868967 CCAAAACTGCAGAAATGAGTGCG 0: 1
1: 0
2: 0
3: 5
4: 78
Right 988819659 5:34868992-34869014 TCTGGAGAGGCCCAGCACAGGGG 0: 1
1: 0
2: 6
3: 53
4: 422
988819651_988819660 28 Left 988819651 5:34868945-34868967 CCAAAACTGCAGAAATGAGTGCG 0: 1
1: 0
2: 0
3: 5
4: 78
Right 988819660 5:34868996-34869018 GAGAGGCCCAGCACAGGGGTAGG 0: 2
1: 0
2: 5
3: 42
4: 399
988819651_988819655 11 Left 988819651 5:34868945-34868967 CCAAAACTGCAGAAATGAGTGCG 0: 1
1: 0
2: 0
3: 5
4: 78
Right 988819655 5:34868979-34869001 AGCTTATGCCATGTCTGGAGAGG 0: 1
1: 0
2: 0
3: 11
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988819651 Original CRISPR CGCACTCATTTCTGCAGTTT TGG (reversed) Exonic
902265721 1:15262123-15262145 CACACTCATTTTTGCAGCATAGG + Intronic
918183869 1:182110245-182110267 CACACACAAATCTGCAGTTTTGG - Intergenic
921750177 1:218783146-218783168 CGCATGCATTTCTGAAGTGTTGG + Intergenic
1064578357 10:16768715-16768737 CACATTCAGTTCTTCAGTTTAGG - Intronic
1072137610 10:92561839-92561861 CACAATCATTTCTGTACTTTCGG + Intronic
1072942480 10:99779050-99779072 CTTACTTATTTTTGCAGTTTTGG + Intergenic
1085285787 11:75359705-75359727 CGCAGTCATCTCAGCAATTTGGG + Intergenic
1085452169 11:76640996-76641018 CACACTCATCCCTGCCGTTTGGG + Intergenic
1089068827 11:115682795-115682817 CGCACTCCTTTCTGGAGGCTTGG - Intergenic
1090968818 11:131622057-131622079 CCCACACATTTCTCCAGTGTGGG - Intronic
1096888719 12:54744297-54744319 CTTTCTCACTTCTGCAGTTTGGG + Intergenic
1099123936 12:78728860-78728882 CTCATTTTTTTCTGCAGTTTAGG + Intergenic
1108829057 13:54453850-54453872 CGAAGTCATTTCTGCATGTTTGG + Intergenic
1109223977 13:59670451-59670473 CTTGCTCATTTCTACAGTTTTGG - Intronic
1112888965 13:104208940-104208962 CGCAGTCATTTCTGCCCTTCTGG - Intergenic
1113565235 13:111315790-111315812 ACGACACATTTCTGCAGTTTAGG - Intergenic
1118524755 14:66626256-66626278 TGCACTTATATCTGCATTTTAGG - Intronic
1122429042 14:101628497-101628519 CGCACTCATTTCTGCAAAGAAGG - Intergenic
1127043047 15:54998171-54998193 AGCACTCATTTCTACACATTAGG + Intergenic
1139087643 16:63607122-63607144 CACATTTATTTCTGCAGTTGAGG - Intergenic
1144118452 17:12125339-12125361 CGCTCTGATGTCTGGAGTTTGGG + Exonic
1146697876 17:34925200-34925222 TTCACTCATTTTAGCAGTTTTGG - Intergenic
1148538159 17:48457827-48457849 GGCCCTCAATTCTGCAGCTTTGG + Intergenic
1148824929 17:50385695-50385717 CACATTCATTTCTGAAGCTTGGG - Intronic
1149741586 17:59051387-59051409 AGCACTGAATTCTGCAATTTGGG + Intronic
1154243519 18:12674498-12674520 CGGAATCATTTTTTCAGTTTAGG - Intronic
1159716927 18:71835558-71835580 TGGACTCAGTTCTTCAGTTTTGG + Intergenic
1161285632 19:3467025-3467047 CGTGCCCATCTCTGCAGTTTGGG + Intronic
1162306956 19:9880831-9880853 AACACACATTTCTGCAGCTTTGG + Intronic
927928306 2:27027830-27027852 CACATTCATTTCTGCACTCTTGG - Intergenic
929910785 2:46087782-46087804 TGCATTCTGTTCTGCAGTTTGGG + Intronic
933630481 2:84651011-84651033 AGCAGTCATTTCTGCTGTGTAGG + Intronic
934041412 2:88130311-88130333 CTCTCTCCTTTCTGCAGTCTGGG - Intergenic
937017615 2:118620046-118620068 TGGAGTCATTTCTGCAGTCTAGG - Intergenic
941670191 2:168284581-168284603 CACTGTCATTTCTGCAGATTGGG + Intergenic
941916510 2:170817156-170817178 AGCACTCATTTCGGGAGGTTGGG - Intronic
945759750 2:213900136-213900158 TGTACCCATTTCTGCATTTTAGG - Intronic
1172296378 20:33814024-33814046 CCCAGCCGTTTCTGCAGTTTTGG + Intronic
1172745492 20:37204550-37204572 AGCACTATCTTCTGCAGTTTTGG - Intronic
1173712800 20:45175444-45175466 CTCACTCATTTCTACATTTTTGG - Intronic
1174784026 20:53416044-53416066 CGCAGTCAGCTCTGCAATTTAGG + Intronic
1178249792 21:30991567-30991589 CTCACTCATTTCTCCATTTTTGG + Intergenic
1184911713 22:47539834-47539856 CGTACTCATTGCTCCAGTTTAGG - Intergenic
950397601 3:12745848-12745870 AGCTCACAGTTCTGCAGTTTGGG - Intronic
952115161 3:30170268-30170290 CTCACCCATTTCAGAAGTTTAGG - Intergenic
953759463 3:45675106-45675128 CCCACCCATTTCTTCAGTGTTGG - Intronic
956980976 3:74636960-74636982 CTCTCACATTTCTGGAGTTTGGG - Intergenic
961775493 3:129281356-129281378 AGGACTCATTTCTGCATTATAGG + Intronic
966992133 3:185243173-185243195 CTCTCCCATTTCCGCAGTTTGGG + Intronic
970436842 4:16043892-16043914 AGAACTCATTTCTGCAGACTTGG - Intronic
970879309 4:20909585-20909607 CTTAGTCATTTCTGCTGTTTGGG + Intronic
971489474 4:27195958-27195980 CGCACTTATGTTTGCAGGTTAGG + Intergenic
973739828 4:53909135-53909157 AGCACTCATTTTTGCAGATGAGG + Intronic
975395069 4:73865102-73865124 CGCTCTCATTGCGTCAGTTTTGG + Intergenic
984591690 4:181624749-181624771 TGCCCACAGTTCTGCAGTTTGGG + Intergenic
987700077 5:21386194-21386216 CGCAATCATTTCTGCAATCCTGG - Intergenic
988752331 5:34201887-34201909 CGCAATCATTTCTGCAATCCTGG + Intergenic
988819651 5:34868945-34868967 CGCACTCATTTCTGCAGTTTTGG - Exonic
990258755 5:53998878-53998900 CCCACTCATGTCTGCTATTTGGG - Intronic
991740095 5:69662714-69662736 CGCAATCATTTCTGCAATCCTGG + Intergenic
991757404 5:69890469-69890491 CGCAATCATTTCTGCAATCCTGG - Intergenic
991791670 5:70242455-70242477 CGCAATCATTTCTGCAATCCTGG + Intergenic
991819558 5:70538831-70538853 CGCAATCATTTCTGCAATCCTGG + Intergenic
991836807 5:70766351-70766373 CGCAATCATTTCTGCAATCCTGG - Intergenic
991884119 5:71242793-71242815 CGCAATCATTTCTGCAATCCTGG + Intergenic
992189079 5:74273007-74273029 CCCACACATTTCTGAGGTTTAGG + Intergenic
1003306091 6:4930933-4930955 CGCACTAATTTCCACAGTTTGGG + Intronic
1005214454 6:23508814-23508836 CTCACTTATTTTTGCTGTTTTGG + Intergenic
1005550496 6:26908610-26908632 CGCAATCATTTCTGCAATCCTGG + Intergenic
1015279831 6:131421205-131421227 CCGTCTCATGTCTGCAGTTTGGG - Intergenic
1023979303 7:45057895-45057917 CACACGCAATTCTGAAGTTTAGG + Intronic
1031165798 7:118225324-118225346 CCCACTAATTTTTGCATTTTTGG - Intronic
1031883836 7:127225190-127225212 CACAGTCATTTCTGCTGTTCTGG + Intronic
1033011423 7:137626567-137626589 TGAAGTCATTTCTGCAGTTTTGG - Intronic
1034050728 7:147981614-147981636 CCCAACCATTTCAGCAGTTTTGG + Intronic
1040570044 8:48600437-48600459 CTCACTCACTTCTGCTGTTCTGG + Intergenic
1043799985 8:84596632-84596654 GTAACTCACTTCTGCAGTTTGGG - Intronic
1057419190 9:94895929-94895951 ACTACTCATTTCTGCAGTTGTGG - Intronic
1057611084 9:96544372-96544394 TGCCCTCATTGCTGTAGTTTTGG - Intronic
1058308629 9:103473220-103473242 CCCACTCCTTTTTGGAGTTTAGG + Intergenic
1059127094 9:111699992-111700014 AGCACTGATTTATGCAGCTTTGG - Exonic
1189518211 X:41737351-41737373 TGCTCACAATTCTGCAGTTTGGG - Intronic
1192014823 X:67317743-67317765 CTCTCTCACTTCTGCAGTTGGGG + Intergenic
1192820101 X:74636483-74636505 CATTCCCATTTCTGCAGTTTGGG - Intergenic