ID: 988821230

View in Genome Browser
Species Human (GRCh38)
Location 5:34888129-34888151
Sequence CTGTAAACTCACATGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2090
Summary {0: 1, 1: 11, 2: 86, 3: 562, 4: 1430}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988821230_988821234 4 Left 988821230 5:34888129-34888151 CCTTCCACCATGTGAGTTTACAG 0: 1
1: 11
2: 86
3: 562
4: 1430
Right 988821234 5:34888156-34888178 AAGATGGCTGTCAATGAATCAGG 0: 1
1: 3
2: 21
3: 67
4: 350
988821230_988821236 11 Left 988821230 5:34888129-34888151 CCTTCCACCATGTGAGTTTACAG 0: 1
1: 11
2: 86
3: 562
4: 1430
Right 988821236 5:34888163-34888185 CTGTCAATGAATCAGGAAGTGGG 0: 2
1: 6
2: 35
3: 139
4: 487
988821230_988821235 10 Left 988821230 5:34888129-34888151 CCTTCCACCATGTGAGTTTACAG 0: 1
1: 11
2: 86
3: 562
4: 1430
Right 988821235 5:34888162-34888184 GCTGTCAATGAATCAGGAAGTGG 0: 1
1: 3
2: 35
3: 94
4: 384

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988821230 Original CRISPR CTGTAAACTCACATGGTGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr