ID: 988823367

View in Genome Browser
Species Human (GRCh38)
Location 5:34910231-34910253
Sequence CTGGGTAACGAGATGGACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 81}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988823367_988823372 -3 Left 988823367 5:34910231-34910253 CCATGGTCCATCTCGTTACCCAG 0: 1
1: 0
2: 0
3: 8
4: 81
Right 988823372 5:34910251-34910273 CAGGCTGAGAGAGATCACTGAGG 0: 1
1: 1
2: 1
3: 45
4: 400

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988823367 Original CRISPR CTGGGTAACGAGATGGACCA TGG (reversed) Intronic
900886310 1:5417978-5418000 CAGGGGAAGGACATGGACCAAGG - Intergenic
903024844 1:20420119-20420141 CTGGGGAGCATGATGGACCAAGG + Intergenic
903870771 1:26432806-26432828 CTGGGGAATCAGATGGACTATGG - Intronic
904609919 1:31720208-31720230 CTGGATAACGAGGAGGACCAAGG + Intergenic
905244630 1:36603971-36603993 CTTGGTAACCAGACAGACCAGGG + Intergenic
909341454 1:74536222-74536244 CTAGGTAAAGACATGAACCAGGG - Intronic
912694720 1:111832599-111832621 CTAGGTAACCAGCAGGACCAGGG - Intronic
918041763 1:180917956-180917978 CTGAGTAAATAGAGGGACCATGG - Intronic
920742889 1:208598150-208598172 CTGGGAAAAGAGATGGAGGAGGG + Intergenic
920993382 1:210962145-210962167 CTGAGTAAGGAGATGGAACTAGG - Intronic
1063439897 10:6064212-6064234 CTTGGTTCTGAGATGGACCATGG + Intergenic
1069225658 10:65941283-65941305 ATGGGTAAGAACATGGACCATGG - Intronic
1070761409 10:79026607-79026629 CTGGGTGAGGAGCTGGACCCTGG + Intergenic
1075192211 10:120320092-120320114 CTGGCTAGCGGGAGGGACCAGGG - Intergenic
1077522778 11:3046123-3046145 CTGTGTAACAGAATGGACCATGG - Intronic
1078715579 11:13836150-13836172 CGGGGTACAGAGATGGACCTGGG + Intergenic
1085260502 11:75201941-75201963 CTTGGTCACCAGAGGGACCAAGG - Intronic
1087095257 11:94311995-94312017 CTTGGTCTCGAGATGGACAATGG - Intergenic
1088906106 11:114156546-114156568 CCAGGGAACAAGATGGACCAGGG - Intronic
1092633731 12:10416452-10416474 CTTGGTTATGAGATGGACCAGGG - Intronic
1092634777 12:10431888-10431910 CTTGGTTATCAGATGGACCAGGG - Intronic
1103360973 12:120353371-120353393 CTGGGTAACCTGATGGGGCAAGG + Exonic
1105762034 13:23524228-23524250 CTGGTTAACCACATGGACCTGGG - Intergenic
1107313241 13:39103184-39103206 CTGGGTCACGAGGTAGACAATGG - Intergenic
1112649689 13:101381170-101381192 CTGGGTGACAAGAAGGACAATGG + Intronic
1115486457 14:33915556-33915578 CTGGATAGTGAGATAGACCATGG + Intergenic
1122631304 14:103108967-103108989 CTGGGGAAGGGGATGAACCAGGG - Intronic
1129415111 15:75372143-75372165 CTGGGTAGATAAATGGACCAAGG - Exonic
1133438418 16:5800290-5800312 ATGAGTAACGAAATGGACTATGG - Intergenic
1134072587 16:11269907-11269929 ATGAGTAACCACATGGACCAAGG + Intronic
1142352170 16:89585554-89585576 GTGGGGGACGGGATGGACCAAGG + Intronic
1144596698 17:16575890-16575912 CTGGGTAAAGAACTTGACCATGG + Intergenic
1146562818 17:33886181-33886203 CTGGCTGAAGAGATGGACAAAGG + Intronic
1148918617 17:51007151-51007173 TTGGGGAACGAGATGGGACAGGG + Intronic
1151268251 17:72973257-72973279 CTGGGTCAGCAGAAGGACCAGGG + Intronic
1156074393 18:33255749-33255771 CTGGGACAGGAGATGGAGCAAGG + Intronic
1159168840 18:64736592-64736614 CTGGGTAACTTGATGGCTCATGG - Intergenic
1160707573 19:536619-536641 CTGGGTAAGGAGAAGGCCCCAGG - Intronic
1168314470 19:55478451-55478473 CTGGGTGACCAGAGTGACCAGGG + Intronic
929615231 2:43301517-43301539 CTGGGTACTGAGATGGAATAGGG - Intronic
929956806 2:46464383-46464405 CATGGGAATGAGATGGACCATGG - Intronic
930287723 2:49453071-49453093 CTGCGTAACTAAATGGTCCAAGG + Intergenic
933250672 2:80025180-80025202 GTGGGTAGCGGGATGGGCCAGGG + Intronic
946227269 2:218270599-218270621 CGGGGTAAGGAGAGGGACCCCGG + Exonic
1169644320 20:7792383-7792405 TTGGGTAACGAGTTATACCAAGG - Intergenic
1170151813 20:13234322-13234344 CTGGGTAAAGAAATATACCATGG - Intronic
1171238414 20:23546384-23546406 CAGGGTCAAGAGAAGGACCAAGG + Intergenic
1171243252 20:23588043-23588065 CAGGGTCAAGAGAAGGACCAAGG - Intergenic
1175046042 20:56106485-56106507 CACGGAGACGAGATGGACCAGGG + Intergenic
1175332654 20:58175914-58175936 CTGGGTGACGGGATGGACAAGGG + Intergenic
1181539260 22:23564677-23564699 CTGGGGAACGACATGAGCCAAGG - Intergenic
1181978828 22:26751978-26752000 TTGGGTAAAGAGACTGACCAAGG - Intergenic
1183423599 22:37725897-37725919 TTGGGTACCGAGATGCACCCCGG + Exonic
1183602187 22:38846225-38846247 CTGGGGATAGAGATGGGCCAAGG - Intergenic
1184255812 22:43286264-43286286 CAAGGTCACGAGATGGTCCATGG + Intronic
1184710429 22:46246424-46246446 CAGGGGGACGAGATGGGCCAGGG - Intronic
949826185 3:8168335-8168357 CTGGGGAAGGAGTTGGATCAGGG - Intergenic
950712359 3:14821352-14821374 CTGGGGAAGGAGATGGACCGTGG - Exonic
956974089 3:74560095-74560117 CTGTGAAACGAGATAGCCCAGGG + Intergenic
957119753 3:76074513-76074535 ATGGGTAAAGAGATGGACAGAGG + Intronic
973918689 4:55662724-55662746 CTGGGTGAAGAGCAGGACCAGGG - Intergenic
976813334 4:89120325-89120347 CTGAGGAACGTGATGGACCCAGG - Intergenic
981229930 4:142340711-142340733 CAGGCTAACGAGAAGGACCCTGG - Intronic
981758427 4:148167194-148167216 CTGGGTCACAAGGTGGCCCATGG + Intronic
982765462 4:159342813-159342835 CTGGGGAATGAGATGGCACAGGG - Intronic
985555129 5:554730-554752 CTGGGTCACGGGATGAACCGGGG + Intergenic
988823367 5:34910231-34910253 CTGGGTAACGAGATGGACCATGG - Intronic
1000291141 5:159872681-159872703 CTTGGTCAAGAGATAGACCAAGG + Intergenic
1000772437 5:165372271-165372293 CTGGGTATGGAGGGGGACCAAGG - Intergenic
1002322359 5:178383417-178383439 CTGGGGAACAAGCTGGACCAAGG - Intronic
1004822931 6:19387769-19387791 CTGTGTAAAGAGATAAACCAAGG + Intergenic
1007041527 6:38726759-38726781 GTGAGTAAAGAGATGGAACAAGG + Intronic
1008260576 6:49361423-49361445 CTGGGTAAAGTGATAGACCCAGG - Intergenic
1008483871 6:52014554-52014576 CTGGATAAACAGATGGATCATGG + Intronic
1014575668 6:123068404-123068426 CTGGTGAACGAGATGGACTTAGG + Exonic
1019609843 7:1930851-1930873 CTGGGTCACGAGAGAGACCAGGG - Intronic
1020000832 7:4754634-4754656 CTGGGTCACCAGGTGCACCACGG - Intronic
1021475785 7:21059099-21059121 CTGGGAAATGAGATGAACAAAGG - Intergenic
1029413564 7:100429972-100429994 CGGGGTAACGAGGGGGATCAGGG - Exonic
1030394940 7:108974257-108974279 CTGGCTAAGCAGATGGACTATGG + Intergenic
1030886189 7:114940914-114940936 CTGGATAACAAGATGGAATAGGG - Intronic
1031919952 7:127593199-127593221 CTGGGTAAGGAGAAGGGCCTAGG - Intronic
1033652159 7:143351785-143351807 CTGGGGAAGGAGATGGCACAGGG - Exonic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1047759419 8:127943093-127943115 CTGAGTCACGAGATGGTCCATGG - Intergenic
1049189750 8:141280471-141280493 CTGGGTAACCAAATGCAACATGG + Intronic
1056911452 9:90704641-90704663 CTTGGTCATGAGATGGAGCAGGG - Intergenic
1058773541 9:108262511-108262533 CTGGGTATAGAGTTGGACCAGGG - Intergenic
1196527344 X:116741524-116741546 CTGGGTATAGAGAGGGACAACGG - Intergenic
1200846489 Y:7836183-7836205 CTGGGGTACGAGATAAACCAAGG + Intergenic