ID: 988833488

View in Genome Browser
Species Human (GRCh38)
Location 5:35009337-35009359
Sequence TGTAATCTTAGTACTTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83181
Summary {0: 1, 1: 26, 2: 558, 3: 8022, 4: 74574}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988833485_988833488 -2 Left 988833485 5:35009316-35009338 CCAGGCTTGGTGGCTCATGCCTG 0: 402
1: 15873
2: 70880
3: 158220
4: 202551
Right 988833488 5:35009337-35009359 TGTAATCTTAGTACTTCAGGAGG 0: 1
1: 26
2: 558
3: 8022
4: 74574

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988833488 Original CRISPR TGTAATCTTAGTACTTCAGG AGG Intronic
Too many off-targets to display for this crispr