ID: 988838670

View in Genome Browser
Species Human (GRCh38)
Location 5:35061195-35061217
Sequence CTTTAAAAAAAAATAGAGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2911
Summary {0: 1, 1: 1, 2: 35, 3: 353, 4: 2521}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988838668_988838670 -7 Left 988838668 5:35061179-35061201 CCTTGCAAAATGAAAACTTTAAA 0: 1
1: 0
2: 6
3: 93
4: 848
Right 988838670 5:35061195-35061217 CTTTAAAAAAAAATAGAGGAAGG 0: 1
1: 1
2: 35
3: 353
4: 2521

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988838670 Original CRISPR CTTTAAAAAAAAATAGAGGA AGG Exonic
Too many off-targets to display for this crispr