ID: 988838670 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:35061195-35061217 |
| Sequence | CTTTAAAAAAAAATAGAGGA AGG |
| Strand | + |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 2911 | |||
| Summary | {0: 1, 1: 1, 2: 35, 3: 353, 4: 2521} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 988838668_988838670 | -7 | Left | 988838668 | 5:35061179-35061201 | CCTTGCAAAATGAAAACTTTAAA | 0: 1 1: 0 2: 6 3: 93 4: 848 |
||
| Right | 988838670 | 5:35061195-35061217 | CTTTAAAAAAAAATAGAGGAAGG | 0: 1 1: 1 2: 35 3: 353 4: 2521 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 988838670 | Original CRISPR | CTTTAAAAAAAAATAGAGGA AGG | Exonic | ||
| Too many off-targets to display for this crispr | |||||