ID: 988839042

View in Genome Browser
Species Human (GRCh38)
Location 5:35065464-35065486
Sequence TTTCTCCTGGGGCAGCAGCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 425
Summary {0: 1, 1: 1, 2: 5, 3: 35, 4: 383}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988839028_988839042 26 Left 988839028 5:35065415-35065437 CCTTGTGAATCTCCACATAATCC 0: 1
1: 1
2: 1
3: 9
4: 155
Right 988839042 5:35065464-35065486 TTTCTCCTGGGGCAGCAGCCAGG 0: 1
1: 1
2: 5
3: 35
4: 383
988839033_988839042 5 Left 988839033 5:35065436-35065458 CCAAGGGTTTAGCGGAGCCAAAG 0: 1
1: 0
2: 0
3: 5
4: 68
Right 988839042 5:35065464-35065486 TTTCTCCTGGGGCAGCAGCCAGG 0: 1
1: 1
2: 5
3: 35
4: 383
988839031_988839042 14 Left 988839031 5:35065427-35065449 CCACATAATCCAAGGGTTTAGCG 0: 1
1: 0
2: 0
3: 1
4: 34
Right 988839042 5:35065464-35065486 TTTCTCCTGGGGCAGCAGCCAGG 0: 1
1: 1
2: 5
3: 35
4: 383

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988839042 Original CRISPR TTTCTCCTGGGGCAGCAGCC AGG Exonic
900562049 1:3312074-3312096 TGTCGCATGGGGGAGCAGCCGGG - Intronic
900914249 1:5623654-5623676 TTTCTCCATGGCCAGCACCCTGG + Intergenic
901529440 1:9843960-9843982 TATGTCCTGAGTCAGCAGCCTGG + Intergenic
901738908 1:11329709-11329731 TTTCTCCTGGGCCAGGAGAGAGG - Intergenic
902038794 1:13477163-13477185 CTTCTCCTGGGCCAACAACCGGG + Intronic
903140930 1:21338888-21338910 GTGGGCCTGGGGCAGCAGCCAGG - Intronic
903273879 1:22208763-22208785 TTTCTTGTGGGGCAGCGGGCCGG + Intergenic
904424204 1:30413145-30413167 ATTCTCCTGGGGTAGCACACAGG - Intergenic
904424380 1:30414149-30414171 ATTCTCCTGGGGTAGCACACAGG - Intergenic
904999451 1:34656986-34657008 TACCTACTGGGGCAGCAGGCTGG + Intergenic
906538272 1:46564420-46564442 TTTCACCTGGGTCAGGAGTCAGG + Intronic
906654837 1:47540544-47540566 GTTGGCCTGGGGCAGCAGCCAGG + Intergenic
906677495 1:47703592-47703614 TTTCTTCTGGGGAGCCAGCCAGG + Intergenic
909673191 1:78211699-78211721 CCTCTCCTGGGGCCCCAGCCTGG + Intergenic
910438526 1:87229321-87229343 TTTAACCTGGCACAGCAGCCAGG + Intergenic
910728240 1:90360889-90360911 TGCCTCCTGGGGCTTCAGCCGGG - Intergenic
911051792 1:93677577-93677599 TCTGACCTGGGGCAGCAGCTGGG + Intronic
911183819 1:94884187-94884209 AGTCCCCTGGGGCTGCAGCCAGG - Intronic
911310750 1:96289341-96289363 CCTCTCCTGGGGCTCCAGCCTGG - Intergenic
913349536 1:117842503-117842525 CCTCTCCTGGGGCCTCAGCCTGG + Intergenic
913405238 1:118483725-118483747 TTTCTCACAGGGCAGTAGCCAGG + Intergenic
913487049 1:119341212-119341234 TTTCTTGTGGGGCAGAAACCAGG - Intergenic
914676562 1:149910917-149910939 TTTCTCCTGGGCCAGAAACTCGG + Exonic
915049146 1:153049382-153049404 TCTCTCCTGGGGTGCCAGCCTGG + Intergenic
915051886 1:153084014-153084036 TGTCTCCTGGGGTACCAGCCTGG + Intergenic
915312338 1:155010952-155010974 CTTCTCCAGGAGCAGCAGCTTGG - Exonic
915440825 1:155944518-155944540 AGGCTCCTGGGGCAGCAGCTGGG + Intergenic
916642627 1:166747323-166747345 CTTTTCCTGTGGCAGCAGCTGGG + Intergenic
917469188 1:175311685-175311707 TTTCCCCGGGGGCAGGGGCCAGG - Intergenic
917633975 1:176917468-176917490 CTTATCCTGGGGCAGCAGTGTGG + Intronic
918921221 1:190712983-190713005 TTTCTCCAGGAGAAGCAACCTGG + Intergenic
919905809 1:202077614-202077636 CTTCACCTGGGGCAGCACCCAGG - Intergenic
920129988 1:203724651-203724673 ATTCTCATGAGGCAGCAACCTGG + Intronic
920167308 1:204045019-204045041 TTTCCCCTGTGGCTGGAGCCTGG - Intergenic
920546702 1:206824152-206824174 TTCCCCCTGGGGCAACAGCTAGG - Intronic
922355318 1:224769609-224769631 TTGCTCCAGGGACAGCAGCTTGG - Intergenic
923565739 1:235074512-235074534 TTTATCTTGAAGCAGCAGCCTGG - Intergenic
923855248 1:237838947-237838969 CCTCTCCTGGGGCCCCAGCCTGG + Intergenic
923934658 1:238747381-238747403 TGTCTCATGTGGCAGCAGACAGG - Intergenic
924502084 1:244647252-244647274 TTTCTCATGGTGGAGCAGACAGG + Intergenic
1063145133 10:3289423-3289445 TGTCTTCTGGGGAAGCCGCCTGG + Intergenic
1063270140 10:4499191-4499213 TTTCTCCAGGGCAAGCTGCCTGG + Intergenic
1063305059 10:4890784-4890806 ATTCTCCTGGCCCACCAGCCTGG + Intergenic
1063366668 10:5494882-5494904 TTGCTGCTGGGGGAGTAGCCAGG - Intergenic
1063460948 10:6214778-6214800 CTTCTGCTGGTGCAGCCGCCAGG - Intronic
1065562372 10:26976744-26976766 TTTCTCGTGGCACAGCAGCCAGG + Intergenic
1065938191 10:30540140-30540162 TTTCTTCTGGGGCAAAGGCCAGG + Intergenic
1066573722 10:36802456-36802478 TTTCTCACGTTGCAGCAGCCAGG - Intergenic
1068462996 10:57351336-57351358 TCTCTCCTGGGACCCCAGCCTGG - Intergenic
1069204799 10:65668128-65668150 TTTCCACTGGGGCAGAAACCTGG - Intergenic
1069572867 10:69504867-69504889 TTGCTCCTGGGTCAGCTTCCTGG + Intronic
1069618806 10:69823684-69823706 TGTCTCCCAGGGCAGCATCCTGG - Intronic
1069664429 10:70145447-70145469 TGTCCCCTCGGGAAGCAGCCAGG - Exonic
1069806034 10:71125612-71125634 CTTCGCCTGGGGCCCCAGCCTGG - Intergenic
1070835852 10:79446443-79446465 TCTTTCCTGGGGCAGGAACCCGG - Intergenic
1071069857 10:81679499-81679521 TTTTTGCTGAGGCAGCAACCAGG - Intergenic
1071271492 10:84011565-84011587 TCTCTCCTGAGGCTGCAGTCAGG + Intergenic
1071509617 10:86253306-86253328 TGTGTCCTGGGGCTCCAGCCTGG - Intronic
1072608750 10:97003154-97003176 TTTCTTCTGGGCAAGGAGCCTGG - Intronic
1073045837 10:100637767-100637789 TTTCCCCTGGGGCCTGAGCCAGG + Intergenic
1075058190 10:119235859-119235881 AATCTCCTGGGGCAGAATCCAGG - Intronic
1075415493 10:122259269-122259291 TCTCTCCCAGGTCAGCAGCCTGG - Intergenic
1076983109 11:215719-215741 CTTCTCCTGGGGCTGTACCCAGG - Exonic
1077317120 11:1924594-1924616 TTTCTCTTGGGGCAGCCACGTGG + Intronic
1077926417 11:6685956-6685978 CTTCTCTTGGTGCAGCAGGCTGG + Intergenic
1077981117 11:7301883-7301905 TGTAGCCTGGGGCAGAAGCCTGG + Intronic
1078358870 11:10652974-10652996 TTCCCCATGGTGCAGCAGCCTGG + Intronic
1079771213 11:24461969-24461991 TTTCTATTGGTGCAGCTGCCAGG + Intergenic
1081786353 11:45750531-45750553 TCTGCCCTGGGGCAGCAGCATGG + Intergenic
1081852740 11:46285101-46285123 CCTCTCCTGGTGCAGTAGCCAGG - Intronic
1082008978 11:47437882-47437904 TTACTCCTGGGGCAGCTGCCAGG - Exonic
1083190544 11:61048746-61048768 TTTAGCCGAGGGCAGCAGCCAGG - Intergenic
1083618904 11:64039364-64039386 GTACACCGGGGGCAGCAGCCAGG - Intronic
1084023160 11:66430372-66430394 TTGCTCCCAGGGCAGCAACCTGG - Intergenic
1085341375 11:75733690-75733712 TTTCTCATGAGGTTGCAGCCAGG + Intergenic
1086818683 11:91406579-91406601 TGTCCCATGGGGCAGCTGCCTGG + Intergenic
1087612057 11:100446741-100446763 ATTCTCCTTGGGCAGCAGGAGGG - Intergenic
1088806580 11:113358482-113358504 CCTCTCCTGGGGCCCCAGCCAGG - Intronic
1089213500 11:116821704-116821726 ATTGGCATGGGGCAGCAGCCGGG + Exonic
1089789809 11:120934476-120934498 CTTCTCCTGGGACATGAGCCTGG - Intronic
1090079632 11:123603333-123603355 CTTCTCCAGGGGAACCAGCCCGG + Intronic
1090404473 11:126468517-126468539 TTCCTCCTGGGGAAGGGGCCTGG + Intronic
1090748820 11:129728467-129728489 ATTCTCATGGAGAAGCAGCCAGG + Intergenic
1091421321 12:343192-343214 AATCTGCTGAGGCAGCAGCCTGG + Intronic
1094375984 12:29787687-29787709 TTCCTCCTGGGGCTGCAGCCGGG - Intergenic
1096195788 12:49648029-49648051 TGTCTCCAGAGGCAGCTGCCTGG + Intronic
1097182810 12:57180650-57180672 TGTCCCCTGGGGCAGCAGGAGGG - Exonic
1097228065 12:57490617-57490639 ATTCTGCTGGGGCCGCAGCGGGG - Exonic
1100926893 12:99558680-99558702 CCTCTCCTGGGGCTCCAGCCTGG - Intronic
1101316849 12:103636599-103636621 TTACAGCAGGGGCAGCAGCCAGG - Intronic
1101749603 12:107572545-107572567 GTCCTCCTGGAGCATCAGCCTGG - Intronic
1102192993 12:111002977-111002999 TTTCTTCTGGGCCCTCAGCCTGG + Intergenic
1102300269 12:111766600-111766622 CTTCACCTGGAGCATCAGCCGGG + Intronic
1102698444 12:114818006-114818028 TCTCTCCTGGAGCAGCTGGCAGG + Intergenic
1103700828 12:122847976-122847998 TGTCTCCTGGGGTGGCTGCCTGG + Intronic
1104397336 12:128445629-128445651 TGTCTCCAGCGGCAGCCGCCTGG - Intronic
1104418414 12:128614974-128614996 GTTCTCCTGGGGCAGCTGTGGGG - Intronic
1104751176 12:131240140-131240162 TTCCTTCTGTGGCATCAGCCTGG - Intergenic
1104873589 12:132017520-132017542 TTTCTCCACGGGCAGCACTCAGG + Exonic
1105631703 13:22175973-22175995 TTTCTCTGGGGGCAGCCTCCAGG + Intergenic
1108312725 13:49211785-49211807 TCTTTCCTGGGACAGGAGCCTGG - Intergenic
1110654695 13:77984058-77984080 TTTCTTCTGTGGCCCCAGCCTGG - Intergenic
1111231888 13:85354504-85354526 TCTCTCCTGGGGCCACAGCCTGG + Intergenic
1111841611 13:93456653-93456675 TTTCTCCTGGGGAGACAGGCAGG - Intronic
1114182861 14:20380354-20380376 TGCCTGCTGGGGCAGGAGCCGGG + Exonic
1114341502 14:21750212-21750234 CTTTTCCTGTGGCAGCAGCTGGG + Intergenic
1115883410 14:37945616-37945638 CATCTCCTGGGGCCCCAGCCTGG + Intronic
1116640885 14:47461340-47461362 TTCTTCCTGGTGCAGCTGCCTGG - Intronic
1118355180 14:65007842-65007864 TTTCTCCTGGGCAAGGAGACGGG + Intronic
1118355381 14:65009288-65009310 TTTCTCCTGAGGCTGCTGACTGG + Intronic
1118478525 14:66141371-66141393 CCTCTCCTGGGGCCCCAGCCTGG + Intergenic
1118730777 14:68664809-68664831 TATCTCCTGGGTCAGAAGCTTGG + Intronic
1118880380 14:69820418-69820440 TTTCTCCTGGAAAAGCAGACAGG + Intergenic
1121458076 14:94051883-94051905 TGTCTCCTGGGGCGGCAGGGAGG - Intronic
1121872570 14:97422572-97422594 TTTCTCCTAAGGAGGCAGCCAGG + Intergenic
1121983653 14:98477623-98477645 GTTCTCCTGAGGCAGCAGCCGGG + Intergenic
1122599126 14:102912561-102912583 TGTGTCCTGGGGCAGCTCCCGGG - Intergenic
1122802409 14:104238266-104238288 CTCCTCCTGAGGCTGCAGCCTGG - Intergenic
1128068164 15:64776661-64776683 TTTCTACTGTGGCAGCAGGGCGG - Intergenic
1128111353 15:65078074-65078096 TTTCTCCCTGAGCAGCCGCCAGG - Exonic
1128113873 15:65093507-65093529 TTTCTGCTGGGGCAGGAGGGGGG + Intronic
1128213229 15:65916683-65916705 GTTCTCGTGGGGCAGGAGTCAGG + Intronic
1128242298 15:66109248-66109270 TTGCTCTGGGGGCAGCAGCATGG - Intronic
1128294297 15:66504824-66504846 CTTTTCCTGTGGCAGCAGCCGGG - Exonic
1128340636 15:66820503-66820525 TTTGTCCTGGGGCTCCACCCAGG - Intergenic
1129341899 15:74891674-74891696 TTTGGCCTTGGGCAGGAGCCTGG - Intronic
1129600705 15:76996562-76996584 CTTTTCCTGGGGCTGCAGCCAGG + Intronic
1130992938 15:88887323-88887345 TTTGCCCTGGGGCCCCAGCCTGG - Exonic
1132420011 15:101657375-101657397 CGTCTCCTGGGGCTGCAGTCAGG - Intronic
1134231873 16:12436010-12436032 TTGCTCCTGGGGCAGCTGCTAGG + Intronic
1134336252 16:13302418-13302440 TTCCTCCTGGGGCATCAGGCTGG - Intergenic
1135677081 16:24424941-24424963 TGTCTCCTGGAGAAGCAGGCAGG - Intergenic
1136188880 16:28603868-28603890 GTTCTCCTGGGGCTGCAGAAGGG - Intergenic
1136234679 16:28906131-28906153 GTGCTCCTGGGCCTGCAGCCGGG + Exonic
1137555537 16:49468112-49468134 TCCCTCCTCGAGCAGCAGCCCGG - Intergenic
1137598995 16:49743626-49743648 TGTGTCCCGGGGCAGCAGGCAGG - Intronic
1138109397 16:54311581-54311603 CTTCTCCTGGGTCAGCAGGTGGG + Intergenic
1138371828 16:56533167-56533189 TCTCGCCTTGGGCAGAAGCCTGG - Intergenic
1138756830 16:59496830-59496852 TTTCTCTTGGGGCTATAGCCTGG + Intergenic
1139846820 16:69927327-69927349 TCTCTCCTGGGGCAGCAGAGAGG - Intronic
1141313708 16:82939974-82939996 TGTCTCATGTGGCAGCAGACAGG + Intronic
1141414016 16:83856039-83856061 TCATCCCTGGGGCAGCAGCCTGG - Intergenic
1141672922 16:85502279-85502301 GATCTCCTGGGGAAGCTGCCAGG - Intergenic
1141673264 16:85504003-85504025 TTTCTGCAGGGTCGGCAGCCCGG - Intergenic
1142030359 16:87835438-87835460 CTTCTCTTGGGGCAGCATCTGGG + Intronic
1142246695 16:88973494-88973516 TATCTCCTGGGGCTGCAGTAAGG - Intronic
1142439962 16:90091298-90091320 TCTTTCCTGGGGCAGCCTCCAGG - Intronic
1142483125 17:230573-230595 TTTCTCCTGAGCCAGCAGGATGG - Intronic
1142981321 17:3673769-3673791 TTTCCCGTTGGGCAGCATCCTGG + Exonic
1143544768 17:7589533-7589555 CTTCTCCAGGGGCAGCGTCCCGG + Exonic
1143870960 17:9957019-9957041 AGTGTCCTGGGCCAGCAGCCAGG + Intronic
1144148403 17:12420235-12420257 ATTCTCTTGGGGCAGTAGCTGGG + Intergenic
1145034978 17:19534354-19534376 TGTCTCCTGGCGCAGGAGGCTGG - Intronic
1145234665 17:21200140-21200162 TCACTGCTGGGGCTGCAGCCGGG - Intronic
1145777645 17:27540552-27540574 ACTCTCCTGGGGAAGCTGCCAGG - Intronic
1146233090 17:31131008-31131030 TCTCTCATGGGGCTCCAGCCTGG - Intronic
1146904453 17:36609059-36609081 CCTCTCATGGGGCTGCAGCCAGG - Intergenic
1147132529 17:38417908-38417930 TTGCTCCTGGGACTACAGCCAGG - Intergenic
1147135918 17:38434218-38434240 CTTCTCCTGGAGGAGGAGCCAGG + Intronic
1147632611 17:41941799-41941821 TAACCCCTGGGGCAGCAGGCAGG - Intronic
1148074516 17:44927826-44927848 CTTCTCCTGGGGCCCCTGCCTGG - Intronic
1148823195 17:50372899-50372921 TTTCTCCTGCCTCAGCAGCACGG - Intronic
1149402627 17:56313556-56313578 TTGGTCCTTGGGCTGCAGCCTGG + Intronic
1150285532 17:63951740-63951762 TTCCTCCTGGGGCTGCTGCATGG - Exonic
1150332225 17:64303600-64303622 AGTCTCCAGGGCCAGCAGCCTGG - Intergenic
1151349571 17:73523827-73523849 CTTCTGCTGGGGCAGCATCTGGG - Intronic
1151804263 17:76396004-76396026 TTTGCCCTGGGGCAGTAGCTGGG + Intronic
1152374243 17:79910771-79910793 TTTCTCCGGGGCCAGAAGCACGG + Intergenic
1152541758 17:80980125-80980147 TCTCCCCAGGGGGAGCAGCCAGG + Intergenic
1152957593 18:52256-52278 TCTTTCCTGGGGCAGCCTCCAGG + Intronic
1154076484 18:11207270-11207292 TTTTTCATGGGTCAGAAGCCTGG - Intergenic
1154295590 18:13144270-13144292 TTTCTTCTTGGCCATCAGCCAGG + Intergenic
1154335964 18:13464976-13464998 TGTCTGCTGTGGCAGGAGCCGGG + Intronic
1155103216 18:22634579-22634601 ATTGGCCTGGGACAGCAGCCTGG + Intergenic
1156395001 18:36691372-36691394 TTTATCCTGTGGCAGCAGTGTGG + Intronic
1157535891 18:48457096-48457118 TTTCCTCTGGGTCAGGAGCCAGG - Intergenic
1158509859 18:58080786-58080808 GTTGTCCTGGGGCAGCTCCCAGG - Intronic
1159739598 18:72150073-72150095 TTTCTCCTGGGTAAACACCCAGG + Intergenic
1160838609 19:1136388-1136410 TGTCTTCTGGTGCTGCAGCCGGG + Intronic
1160933187 19:1580378-1580400 GGTTTCCTGTGGCAGCAGCCGGG - Intronic
1160982861 19:1824153-1824175 TGGCTCCGGGGTCAGCAGCCAGG - Intronic
1161077094 19:2291090-2291112 AATCTCCAGGTGCAGCAGCCCGG + Exonic
1161479528 19:4503617-4503639 GTTCTCCAGGGGCAGCTGCTGGG + Exonic
1162349192 19:10138539-10138561 TCTCTCCAGGGGCCGCGGCCAGG + Exonic
1162723484 19:12676037-12676059 TGTCTCCTGGGGCAAGATCCGGG - Exonic
1163265387 19:16217621-16217643 CCTCTCCTGGGGCCCCAGCCTGG - Intronic
1164270802 19:23670024-23670046 TTTTTCCTGGGGCATCTCCCTGG - Intronic
1165148911 19:33749747-33749769 GGTCTCCTGGCTCAGCAGCCTGG - Intronic
1165987928 19:39786931-39786953 TCTCTCCTGGGGGAGAAGCTGGG - Intergenic
1166781706 19:45346611-45346633 GTTCTCCTGGGCCAGCCGCCGGG - Exonic
1167590081 19:50399566-50399588 GTGCTCCTGGGGCAGAGGCCGGG + Intronic
1167852528 19:52212998-52213020 ATCCTCCTGGGGCAGAAGCTGGG - Exonic
1168233696 19:55048810-55048832 TTTCTGCTGGTGCATCAGGCTGG - Intronic
926125674 2:10270339-10270361 TTTCCCCTGGGGCCTCACCCAGG + Intergenic
926670589 2:15573806-15573828 CTTCTCCTTGCTCAGCAGCCTGG + Intergenic
926839053 2:17058267-17058289 TTTGTCTTGGGGAAGGAGCCTGG + Intergenic
927435321 2:23061344-23061366 TGTCTCTGGGGTCAGCAGCCAGG + Intergenic
927465811 2:23335716-23335738 TCTCTGCTGGGGCTTCAGCCAGG - Intergenic
927502599 2:23592415-23592437 TGTGTCCTGGGGCAGCTGCTCGG + Intronic
927832594 2:26365491-26365513 TTTGGCCTGGGGCAGAAGCTGGG - Intronic
930037906 2:47099345-47099367 TCACACCTGGGGCAGCAGCCTGG - Intronic
931772134 2:65506703-65506725 TATCTCCTTGGGCAGAAGACTGG - Intergenic
932658067 2:73627364-73627386 TTCCTCCTGGCTCAGCAGCTAGG + Intergenic
932664694 2:73687401-73687423 TTCCTCCTGGCTCAGCAGCTAGG + Intergenic
933756784 2:85645638-85645660 TTTCAGCTGGGGCAGAGGCCAGG + Intronic
934526801 2:95057056-95057078 TTTCTGATGGGGGTGCAGCCAGG + Intergenic
935847980 2:107187506-107187528 CTTCTTCTGGGGCCCCAGCCTGG + Intergenic
936811985 2:116413481-116413503 CCTCTCCTGGGGCCCCAGCCTGG + Intergenic
937347776 2:121137300-121137322 TTTCTCCTCTGGCAGGAGCCTGG + Intergenic
939452982 2:142397889-142397911 TTTCTTCTGAGACATCAGCCTGG - Intergenic
941080951 2:161059947-161059969 TTTCTCTGGGGGCATCAGTCAGG - Intergenic
942405207 2:175646646-175646668 CCTCTCCTGGGGCCCCAGCCTGG + Intergenic
946791342 2:223303517-223303539 TCATTCCTGAGGCAGCAGCCTGG + Intergenic
947276869 2:228401743-228401765 ATGCTCCTGTGGGAGCAGCCAGG + Intergenic
948273133 2:236688935-236688957 TTTCTCCTGCCGCCGCAGGCGGG + Intergenic
948306654 2:236953343-236953365 TTCTTCCTGGGGCAGCAGCCAGG + Intergenic
948413744 2:237785117-237785139 TTTTCCCTGGGGCAGCAGGCTGG - Intronic
948540782 2:238690262-238690284 GCCATCCTGGGGCAGCAGCCCGG + Intergenic
1169500721 20:6158054-6158076 ATGCTCCTGTGGGAGCAGCCAGG + Intergenic
1170700935 20:18702885-18702907 TTTCTCCTGGGGCCTCTGACTGG + Intronic
1171262572 20:23747280-23747302 TAGCTTCTGGGGCAGCTGCCTGG + Intergenic
1171288690 20:23966863-23966885 TTTCCCCTGGGCCAGGACCCAGG + Intergenic
1171776687 20:29374905-29374927 TCTTTCCTGGGGCAGCCTCCAGG + Intergenic
1171818084 20:29806382-29806404 TCTGTCCTGGGGCAGCCTCCAGG + Intergenic
1171900162 20:30848897-30848919 TCTGTCCTGGGGCAGCCTCCAGG - Intergenic
1172484546 20:35290630-35290652 TCTATCCTGGGTCAGGAGCCAGG - Intronic
1172836566 20:37877156-37877178 TTTCCCATGGGAGAGCAGCCAGG - Intergenic
1173292514 20:41727122-41727144 CTTCTCCTGGGGCCCTAGCCTGG - Intergenic
1173808773 20:45943429-45943451 TCTCGCCTGGGGCAGAAGACAGG - Intronic
1174171849 20:48622636-48622658 ATTCTCCTGGGGCCGTAGGCAGG - Intergenic
1174728652 20:52891913-52891935 TTTCCCCTTCTGCAGCAGCCAGG + Intergenic
1175507151 20:59494110-59494132 TTGCTCCTGGGGAAGAGGCCTGG + Intergenic
1177546162 21:22561789-22561811 TGTCTTCTGGGGCAGCTGCCTGG - Intergenic
1178391053 21:32198658-32198680 TGCCACTTGGGGCAGCAGCCAGG - Intergenic
1178435099 21:32551275-32551297 TTTCTCCTGGTGCAGTGGCAGGG - Intergenic
1178531569 21:33380754-33380776 CAACGCCTGGGGCAGCAGCCAGG + Intergenic
1178928130 21:36792784-36792806 TGCCTCCTGAGCCAGCAGCCAGG + Intronic
1179943349 21:44654071-44654093 TTTCTCCTGGGTTCACAGCCTGG - Intronic
1180032416 21:45221584-45221606 GTTCACCAGGGGCAGCACCCAGG + Intronic
1180180438 21:46116486-46116508 CTGCTCCTGGGGCACCGGCCTGG + Intronic
1180190083 21:46158782-46158804 TGTCTCCTGGGGCAGCACCCGGG - Intergenic
1180192599 21:46173227-46173249 CCTCTCCTGGGGCCCCAGCCTGG + Intronic
1180333527 22:11554892-11554914 TCTGTCCTGGGGCAGCCTCCAGG - Intergenic
1180682613 22:17638859-17638881 TCTCTTCTGGGGCAGGGGCCAGG + Exonic
1181048783 22:20228967-20228989 TAGCTCCTGGGGCAGCACCGTGG - Intergenic
1181122844 22:20683685-20683707 TCTCACCTGGGGCACCTGCCTGG - Intergenic
1181179581 22:21057404-21057426 TCTCACCTGGGGCACCTGCCTGG + Intronic
1181277164 22:21694462-21694484 GTGGTCCTTGGGCAGCAGCCAGG - Intronic
1181303779 22:21902430-21902452 TATCCCCTGGGGCACCACCCAGG + Intergenic
1181745508 22:24952882-24952904 TTTCTCCCGGGGCCTCGGCCGGG - Intronic
1182317978 22:29460332-29460354 ATCCTCCTAGGGAAGCAGCCGGG - Intergenic
1183725845 22:39589302-39589324 TTTCTCCTGGGTATGCACCCAGG + Intronic
1184030408 22:41891066-41891088 TTTCTCCTGGAGCAGCCACCAGG + Intronic
1184101933 22:42345274-42345296 TGACTCCTGGGGCAGGTGCCGGG + Intergenic
1184391251 22:44204842-44204864 TTTGCCTTAGGGCAGCAGCCTGG - Intronic
1184722332 22:46322266-46322288 TGTCTGTGGGGGCAGCAGCCTGG + Intronic
1185243584 22:49760774-49760796 TTTCTCCTAGGCAAGCAGCTTGG - Intergenic
1185258760 22:49850120-49850142 CTTCTCCTGGGGCCACAGCGTGG + Intergenic
1185272980 22:49937123-49937145 ATTCACCTGGGACAGCAGGCTGG - Intergenic
1185320963 22:50200160-50200182 CTTCTCCTGGGGCCACAGCGTGG - Intergenic
949417985 3:3833677-3833699 TCTCTCCTGAGGCAGTTGCCAGG - Intronic
949847270 3:8384537-8384559 ATTCTCCTGTGTCAGTAGCCTGG + Intergenic
951258786 3:20482203-20482225 CCTCTCCTGGGGCTCCAGCCTGG + Intergenic
953179450 3:40582625-40582647 TTTCCCCTGGAACAGCTGCCTGG - Intergenic
953901276 3:46845578-46845600 TTTCTACTGGGAAAGCAGCGGGG - Intergenic
954511871 3:51132472-51132494 TATCTCCTGAGGCAGTTGCCAGG - Intronic
957088397 3:75704744-75704766 TCTTTCCTGGGGCAGCCTCCAGG - Intergenic
960258187 3:115533502-115533524 CCTCTCCTGGGGCCCCAGCCTGG - Intergenic
960695692 3:120394141-120394163 TTTCTCCTGGGACTACAGCTTGG - Exonic
961339896 3:126211114-126211136 TTTCTCCCTTGGCAGCAGCCTGG - Intergenic
961738001 3:129014411-129014433 TCTCTCCTGGGCTGGCAGCCAGG + Intronic
962953029 3:140237603-140237625 TCTCTCCTGGTACTGCAGCCTGG + Intronic
965034868 3:163424988-163425010 TTTCCCCTGAGGCAGTTGCCAGG - Intergenic
965723850 3:171692435-171692457 TTTCTCCTGTGACAGCAACAAGG - Exonic
966489899 3:180516475-180516497 CTTCTCCTGAGGCCCCAGCCTGG + Intergenic
967009500 3:185418812-185418834 CTTTTCCTGTGGCAGCAGCCGGG - Intronic
968357138 3:198117916-198117938 TCTTTCCTGGGGCAGCCTCCAGG - Intergenic
968478299 4:822984-823006 TTTCTCCAGCAGCAGCAACCGGG - Intronic
969227481 4:5808197-5808219 CTTCTGCTGGGACAGCATCCTGG - Exonic
969257458 4:6011863-6011885 CTTCTCCTGGGCCTGGAGCCAGG + Intergenic
970092975 4:12430612-12430634 TCTCCCTTGGGGGAGCAGCCAGG - Intergenic
970101166 4:12524311-12524333 CCTCTCCTGGGGCCCCAGCCTGG + Intergenic
970604678 4:17667956-17667978 CAGCTCCTGGGGCAGCAGCCAGG + Intronic
972793240 4:42392905-42392927 TTTCCCCTGTGGCTGCAGACAGG + Intergenic
972830604 4:42809927-42809949 CCTCTCCTGGGGCCCCAGCCTGG - Intergenic
974108229 4:57495406-57495428 TGTATCCTGGGGTGGCAGCCTGG + Intergenic
975830535 4:78363708-78363730 GTTCTCTTGGGGCAGTAGCTGGG + Intronic
976931269 4:90569870-90569892 ACTCTCCTGTGGGAGCAGCCAGG - Intronic
976948519 4:90799579-90799601 CTTCTCCTGGGGCCCCAGACTGG - Intronic
978043851 4:104101933-104101955 ATTCTCCTAGGGCAGTGGCCAGG - Intergenic
979307358 4:119162396-119162418 GGTCTCCTGGGGCAGCAGTGTGG + Intronic
980053584 4:128060792-128060814 TTTCACCTGGGGGAGGCGCCGGG + Intergenic
980148222 4:129015410-129015432 CCTCTCCTGGGGCCCCAGCCTGG - Intronic
980576421 4:134688151-134688173 CTTCTCCTGGGGCCCCAGCCTGG - Intergenic
980791920 4:137631797-137631819 CCTCTCCTGGGGCCCCAGCCTGG + Intergenic
981276253 4:142901057-142901079 CTTCTCCTGAGGCCCCAGCCTGG - Intergenic
981463246 4:145035478-145035500 ATTGTCATGGGGCAGGAGCCAGG + Intronic
985442521 4:189993652-189993674 TCTTTCCTGGGGCAGCCTCCAGG + Intergenic
986301483 5:6481627-6481649 TTCCTCCTGGGTCAGAAGCCTGG + Intronic
988839042 5:35065464-35065486 TTTCTCCTGGGGCAGCAGCCAGG + Exonic
989147864 5:38266204-38266226 TTTCTCCTGGTGGAGCAGGAAGG + Intronic
989539948 5:42606746-42606768 TTAATCCTTGGGCAGCAGCTGGG + Intronic
990198413 5:53344177-53344199 TTTTTCCTTTGGCAGAAGCCTGG - Intergenic
992255000 5:74912322-74912344 TTACTCCCTGGGCAGCAGCAAGG - Intergenic
992552033 5:77868245-77868267 ATTCCACAGGGGCAGCAGCCTGG + Intronic
995341996 5:111070746-111070768 TGTCACCTGGGGCCTCAGCCCGG - Intronic
996277618 5:121686586-121686608 TTTCTATTGGTGCAGCTGCCAGG - Intergenic
997434032 5:133861295-133861317 TTCATCCTGTGACAGCAGCCAGG - Intergenic
998280936 5:140807193-140807215 GTTTTCCTGGGGAAGCGGCCAGG + Exonic
999212154 5:149899277-149899299 TATCACATGGGGCAGCAACCTGG - Intronic
999270845 5:150295590-150295612 TGTGTCGTGGGGCAGGAGCCAGG - Intergenic
1000353422 5:160370583-160370605 TTTCCTCAGCGGCAGCAGCCGGG + Exonic
1002000773 5:176195241-176195263 TTTCTCCTGAGGCAGAGGCTCGG + Intergenic
1002253563 5:177943729-177943751 TTTCTCCTGAGGCAGAGGCTCGG - Intergenic
1003163399 6:3655364-3655386 CTTCTCCAGGGACAGCTGCCTGG - Intergenic
1003744082 6:8980029-8980051 TTTCTTCTGGGGCAAAAGTCAGG + Intergenic
1004395531 6:15244696-15244718 TTTCTCAGGAGGCAGCCGCCGGG + Intergenic
1006638787 6:35478287-35478309 CCTCTCCTGGGACAGCAGCCTGG - Exonic
1010206074 6:73323526-73323548 CTTGTCCTGGGGCAGCAGGCAGG - Intergenic
1010821357 6:80419382-80419404 TCTCTCCTGGGGCCCCAGCCTGG - Intergenic
1011094761 6:83648450-83648472 TTTCTCTTGGGTAAGCATCCAGG + Intronic
1012448922 6:99334509-99334531 TTTCTCCTGGGGTAACATCAGGG - Intronic
1013181526 6:107720732-107720754 TTTCTCTTGGGGCTGGAGGCTGG + Exonic
1013366948 6:109443861-109443883 CTACTCCTGGGGCAGCAGGAGGG + Exonic
1013992148 6:116265686-116265708 CCTCTCCTGGGGCCCCAGCCTGG - Intronic
1014470810 6:121812492-121812514 CTTCTCCTTGGTCTGCAGCCTGG - Intergenic
1016345687 6:143111746-143111768 TTTCTCCTGGGCCAGCAGCCTGG + Intronic
1017019158 6:150126612-150126634 TTTCTCCTTGAGCAGGAGACAGG - Intergenic
1017405642 6:154115727-154115749 TCTGCCCTGGGGCAGCAACCTGG + Intronic
1017616902 6:156255575-156255597 TTTCTCCTGGTGCAGTGGCAGGG - Intergenic
1018862404 6:167720603-167720625 TTCCTCCTGGGACCGCACCCGGG + Intergenic
1019261147 7:82621-82643 CTACACCTGGGGCTGCAGCCGGG - Intergenic
1019337535 7:492418-492440 TTTCTGATGGGGCGGCAGCTGGG - Intergenic
1019702032 7:2478697-2478719 TCCCTCCTGGGGCGGGAGCCAGG + Intergenic
1020047190 7:5049236-5049258 GTTCTCCTTGGGCAGCAGGCAGG - Intronic
1020143463 7:5624917-5624939 TCTGTCCTGAGGCAGCAGCCCGG - Intronic
1020292551 7:6733094-6733116 GTTCTCCTTGGGCAGCAGGCAGG - Intergenic
1020869107 7:13605463-13605485 CTGCTCCTGGGGCAGCATTCTGG + Intergenic
1022286923 7:28962226-28962248 CTTCTGCTGGAGCAGCATCCTGG + Intergenic
1023157574 7:37266078-37266100 TCTGTCCTTGGGCAGCAGCCTGG + Intronic
1023561190 7:41474777-41474799 TCTCTCCTGAGGCTGCAGCCAGG - Intergenic
1025190712 7:56893565-56893587 TCCCTCCTTGGGCAGGAGCCTGG + Intergenic
1025681231 7:63683359-63683381 TCCCTCCTTGGGCAGGAGCCTGG - Intergenic
1030117268 7:106071462-106071484 TGTCTGCTGGGGCAGGAGGCAGG + Intergenic
1030364641 7:108631346-108631368 TTTCTCATGGGACACCAGGCAGG - Intergenic
1030376183 7:108755870-108755892 CCTCTCCTGGGGCCCCAGCCTGG + Intergenic
1030401678 7:109059338-109059360 CTTCTCCTGGGGCCCCAGCCTGG - Intergenic
1030967692 7:116014055-116014077 TTTCTCCTGGAGAAGAAGGCTGG - Intronic
1031158688 7:118140681-118140703 TTTATCCTGGGCCTGCACCCAGG + Intergenic
1031547535 7:123068557-123068579 CCTCTCCTGGGGCCCCAGCCTGG - Intergenic
1031749050 7:125547190-125547212 TTTCTCATGGTGCTGCAGGCTGG - Intergenic
1032096766 7:128942137-128942159 GTTCACCTGGGCCACCAGCCAGG - Exonic
1032402194 7:131631124-131631146 TTTATCCTGGGGCTGCAGAGTGG - Intergenic
1032874418 7:136022297-136022319 TTTCTCCTGGTTCATCAGTCAGG + Intergenic
1033654483 7:143363157-143363179 TTCCTCCTGGGGCCGCATCTGGG + Intergenic
1034426183 7:151015443-151015465 TGTGTCCTGGAGCAGCTGCCTGG - Intronic
1034528841 7:151683087-151683109 ATTCTCCCAGGGCGGCAGCCAGG + Intronic
1035761015 8:2068805-2068827 CTTCTCCTCTGGCAGCATCCTGG + Intronic
1036617919 8:10403278-10403300 TTTCTCCTGGGACATCACTCAGG - Intronic
1038103429 8:24406487-24406509 CATATCCTGGGGCTGCAGCCGGG - Intergenic
1038327453 8:26582717-26582739 TTTCTACTGGGGTAGCTCCCGGG + Intronic
1038869539 8:31479366-31479388 TTCCTCCTGGGGCAGAAACCAGG - Intergenic
1039612484 8:38930743-38930765 TGGCTGCTGGTGCAGCAGCCAGG + Intronic
1040721553 8:50330245-50330267 TTTCTCATGTGGCAGCAGGAAGG - Intronic
1041921361 8:63186217-63186239 ATTCTCTTGGGGAAGCAGCGTGG + Exonic
1043216422 8:77595784-77595806 TTTCCCCTGGGGAAGCAACAAGG + Intergenic
1044313743 8:90726375-90726397 TCTCTCCTGGGGCCCCAGACTGG + Intronic
1045485936 8:102631233-102631255 TTGCTGCTGGGGCAGCAGCAGGG + Intergenic
1046822799 8:118652626-118652648 CTTCTCCTGGTGCCTCAGCCGGG - Intergenic
1047175910 8:122540135-122540157 TCTCTCCTGAGGTAGCAGTCAGG - Intergenic
1047553199 8:125899156-125899178 TCTCTCTGGGGGCAGCATCCTGG - Intergenic
1048572245 8:135665842-135665864 ATGCCCCTGGGGAAGCAGCCTGG + Intergenic
1048776269 8:137950103-137950125 GCACTCCTGGTGCAGCAGCCTGG - Intergenic
1049280741 8:141742885-141742907 TTTCACCTGGGGGCCCAGCCAGG + Intergenic
1049285840 8:141774789-141774811 ATCCTGCTGGGGCTGCAGCCAGG - Intergenic
1049430690 8:142562699-142562721 TGTCTCCTGGGCCAAAAGCCTGG - Intergenic
1050116195 9:2265865-2265887 TTTGTCATGGGTCAGAAGCCAGG - Intergenic
1050475304 9:6034643-6034665 CCTCTCCTGGGGCTCCAGCCTGG + Intergenic
1050506493 9:6354180-6354202 TTCCTGCAGGGGCAGGAGCCCGG - Intergenic
1050623440 9:7478354-7478376 TTTTCCTGGGGGCAGCAGCCGGG - Intergenic
1051110200 9:13627142-13627164 CCTCTCCTGGGGCCCCAGCCTGG + Intergenic
1051915378 9:22200804-22200826 ACTCTCCTGGGGCCACAGCCTGG - Intergenic
1052534149 9:29726526-29726548 TCTCTCCTGGGGCCCAAGCCTGG + Intergenic
1052879501 9:33592531-33592553 GTTCTCCTGGGCCAGCTGCAAGG + Intergenic
1053496477 9:38551701-38551723 GTTCTCCTGGGCCAGCTGCAAGG - Intronic
1053869975 9:42480756-42480778 TTTCTCATGGTTCAGCAGGCTGG - Intergenic
1054779295 9:69151700-69151722 TTGCTCCTGGAGCTGCAGCCGGG - Intronic
1056326796 9:85486807-85486829 TTTCTGATGTGGCAGCAACCTGG + Intergenic
1056572494 9:87828204-87828226 TCTCTCCTGGGGCCCCAGCCTGG + Intergenic
1057497145 9:95570317-95570339 AATCTCCTGTGGCTGCAGCCCGG + Intergenic
1058999083 9:110329623-110329645 TTTCTCCTGGGAGAGCAGTTGGG + Intronic
1059057598 9:111000425-111000447 TTTCTCCTGTTTCAGCAGTCAGG + Intronic
1059892420 9:118817641-118817663 TTATTCCTGAGGCACCAGCCAGG - Intergenic
1061150238 9:128824044-128824066 TACCTCCTGGGGCTGCGGCCAGG - Intronic
1062232200 9:135487786-135487808 TGTCTCCTGGGGGGGCAGGCAGG + Exonic
1062355141 9:136158342-136158364 TTGTTCCTGTGGCAGCTGCCAGG + Intergenic
1186582659 X:10837551-10837573 TGTTTCCTGTGTCAGCAGCCTGG - Intergenic
1186685764 X:11922924-11922946 CCTCTCCTGGGGCCCCAGCCAGG + Intergenic
1186855230 X:13619913-13619935 TTTCTCATGAGGCAACAGCAGGG + Intronic
1187939491 X:24367977-24367999 TTTGTCCTGGGATAGCATCCAGG - Intergenic
1188833516 X:34929769-34929791 TCTGTCCTGGGGCTGCAGCAAGG - Intergenic
1189235653 X:39484938-39484960 GGCCTCCTGGGCCAGCAGCCTGG + Intergenic
1189366479 X:40392956-40392978 TTTGGCCTGGGGAATCAGCCAGG + Intergenic
1189558191 X:42166415-42166437 CCTCTCCTGGGGCCCCAGCCTGG - Intergenic
1190852783 X:54262972-54262994 CTTCTGCTGGGGCAGGAGCAGGG + Intronic
1192038207 X:67588658-67588680 AATGTCCTGGGGCATCAGCCGGG - Intronic
1192522716 X:71815887-71815909 TTTCCCTTGGGACAGCTGCCTGG - Intergenic
1192872238 X:75195308-75195330 CCTCTCCTGGGGCCCCAGCCTGG - Intergenic
1193593490 X:83419092-83419114 CTTCTCCCGGGGCCCCAGCCTGG + Intergenic
1194130417 X:90074369-90074391 CCTCTCCTGGGGCCCCAGCCTGG - Intergenic
1194217486 X:91148479-91148501 CTTCTCCCAGGGCACCAGCCAGG - Intergenic
1194583817 X:95708828-95708850 TTTGGCATGGGGCAGAAGCCAGG - Intergenic
1194925589 X:99819866-99819888 CCTCTCCTGGGGCCCCAGCCTGG + Intergenic
1195289135 X:103414550-103414572 CCTCTCCTGGGGCCCCAGCCTGG - Intergenic
1196456285 X:115893609-115893631 TGTCTCCTGGGGCAGCCCCATGG + Intergenic
1197211821 X:123834329-123834351 TTTGACCTGTGGCAGGAGCCTGG - Intergenic
1197482523 X:127004854-127004876 CTTCTCCTGGGTCCCCAGCCTGG + Intergenic
1198075617 X:133190498-133190520 TTTCTCCTGAGGCAGGAGAGAGG + Intergenic
1198557759 X:137813950-137813972 TTAATCATGGGGCAGAAGCCAGG + Intergenic
1199975600 X:152893397-152893419 CTGCTTCTGGGGCAGCAGCAGGG + Intergenic
1200047018 X:153408595-153408617 TGTCTCCTGGGACTGCAGCCTGG + Intergenic
1200553999 Y:4612271-4612293 CTTCTCCCAGGGCACCAGCCAGG - Intergenic
1201068556 Y:10123385-10123407 TCTGTCCTGGGGCAGCCTCCAGG - Intergenic
1201529938 Y:14980513-14980535 CTTCTCCTGAGGCAGTTGCCAGG - Intergenic
1201950018 Y:19553306-19553328 CTGCTTCTGGGGCAGCAGTCAGG - Intergenic