ID: 988839364

View in Genome Browser
Species Human (GRCh38)
Location 5:35068104-35068126
Sequence AAAGGCTGGCTGAAACTACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 1, 2: 0, 3: 9, 4: 148}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988839358_988839364 29 Left 988839358 5:35068052-35068074 CCTTCACACAACTTTCTGTTAAC 0: 1
1: 0
2: 0
3: 14
4: 195
Right 988839364 5:35068104-35068126 AAAGGCTGGCTGAAACTACCAGG 0: 1
1: 1
2: 0
3: 9
4: 148
988839360_988839364 -5 Left 988839360 5:35068086-35068108 CCAGGAGAGACAGTCCAAAAAGG 0: 1
1: 0
2: 0
3: 15
4: 186
Right 988839364 5:35068104-35068126 AAAGGCTGGCTGAAACTACCAGG 0: 1
1: 1
2: 0
3: 9
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988839364 Original CRISPR AAAGGCTGGCTGAAACTACC AGG Intronic
902209963 1:14897864-14897886 AACCGCTTGCTGAAACTAACCGG + Intronic
905003020 1:34688345-34688367 AAAGGCTGTCTGAACCCAGCAGG + Intergenic
905886650 1:41495448-41495470 AAAGGCTGGCAGAGACATCCTGG + Intergenic
907956431 1:59232514-59232536 AAAGGCTTTCTGAAAGTACTGGG + Intergenic
910979459 1:92944845-92944867 ACAGGCTGGCTGAAACTCCTGGG + Intronic
911899894 1:103489394-103489416 AAAGCCTGGTTGATAGTACCGGG + Intergenic
915590636 1:156868360-156868382 AAAGGCTGGGGGAAACTGCCTGG + Intronic
919342002 1:196322414-196322436 AAACACAGGCTGAAACTAACCGG + Intronic
921577689 1:216855976-216855998 CCAAGCTGGCTGAAACTATCAGG - Intronic
1062957290 10:1548735-1548757 AAAAGCTGACAGAAACTACATGG + Intronic
1063390491 10:5647167-5647189 CCAGGCTGGCTGAAACTCCCGGG + Intronic
1065086652 10:22185269-22185291 AAAGCCTGGCTGAAGGTACAAGG - Intergenic
1065132957 10:22641236-22641258 AAAAGCTGGGTGAAACTCCAGGG + Intronic
1067723195 10:48745691-48745713 AGAGGCTGGCTGGAAGTACCAGG - Intronic
1068062653 10:52088507-52088529 AAGGGCTGGAGGAAACTAGCAGG + Intronic
1070399681 10:76042372-76042394 AAAGGATGGCTGAAGCTTCTTGG + Intronic
1073964310 10:108971054-108971076 AAATTCTGGCTGAAAGTAACAGG + Intergenic
1074675046 10:115838898-115838920 AAAGCATGTATGAAACTACCTGG - Intronic
1081276565 11:41156864-41156886 AAACTCATGCTGAAACTACCAGG + Intronic
1084569036 11:69948668-69948690 ACAGGGTGGCTCAAACTTCCAGG + Intergenic
1086547573 11:88015936-88015958 GAAGGATGGCTGAAAGTACAAGG - Intergenic
1086836458 11:91630067-91630089 TATGGCTGGCTGAAAACACCAGG + Intergenic
1088049126 11:105489648-105489670 CAAGGCTGGCTGAACCCAGCTGG + Intergenic
1088063002 11:105680155-105680177 AAAGGAGGGATGCAACTACCAGG - Intronic
1088784865 11:113172152-113172174 TAGGGCTGGCTGAAACAAACTGG - Intronic
1090532083 11:127601187-127601209 AAAGGCTACCAGAAACTACAAGG - Intergenic
1095414516 12:41961884-41961906 AAAGGATGGCTGACAGTCCCAGG + Intergenic
1096897990 12:54844214-54844236 AAAGTCTTGATGAAGCTACCTGG + Intronic
1098339289 12:69435197-69435219 AAAGGCTGGATGAGATTGCCAGG + Intergenic
1100019003 12:90047272-90047294 GAAGGCTGGTGGAATCTACCAGG - Intergenic
1102066622 12:109981884-109981906 AGAAGCTGGCTGAAACTATCAGG - Intronic
1102235988 12:111295107-111295129 AAATCCTGGCAGAAACTAACAGG + Intronic
1106736267 13:32590766-32590788 GAAAGCTAACTGAAACTACCTGG - Intronic
1108424918 13:50289890-50289912 AAGGGCAGGCTGAGACTCCCAGG + Intronic
1110509164 13:76328716-76328738 AATGGATGGCTGAAAATAACAGG + Intergenic
1111381957 13:87467427-87467449 AAAAGTTGGCTGTAATTACCTGG - Intergenic
1117515601 14:56498203-56498225 AAGGGCAGGCTGAAACTCTCAGG + Intronic
1117892571 14:60442681-60442703 AAAGGATGGTTGAAACTGTCTGG - Intronic
1118597436 14:67446738-67446760 AAAGGTGGGCTGAAGCTAACAGG + Intergenic
1119424196 14:74525105-74525127 AAGGTCTGGCTGCAGCTACCTGG + Exonic
1119490201 14:75025481-75025503 TAAGGATGGCTGAAAATACTTGG - Intronic
1123471808 15:20560865-20560887 CATGCCTGGCTGAAAATACCAGG + Intergenic
1123646198 15:22439486-22439508 CATGCCTGGCTGAAAATACCAGG - Intergenic
1123732110 15:23155856-23155878 CATGCCTGGCTGAAAATACCAGG + Intergenic
1123750245 15:23353238-23353260 CATGCCTGGCTGAAAATACCAGG + Intergenic
1124282614 15:28377154-28377176 CATGCCTGGCTGAAAATACCAGG + Intergenic
1124300088 15:28534456-28534478 CATGCCTGGCTGAAAATACCAGG - Intergenic
1124357091 15:29003720-29003742 AAGGGCAGGCTGGAACTCCCAGG + Intronic
1124716078 15:32063536-32063558 CAAGGCTTGGGGAAACTACCTGG - Intronic
1124798698 15:32808383-32808405 AAAGACTGGCTGCAACTATGTGG - Intronic
1125054912 15:35347360-35347382 TCAGGCTGGCTCAAACTCCCGGG + Intronic
1125319985 15:38475562-38475584 AAAGGCTGGAAGATTCTACCGGG - Intronic
1126546683 15:49881677-49881699 AAAAGCTGGCTGGCACTCCCTGG + Intronic
1127719083 15:61682164-61682186 AAAGGCTCTCTGAACCTAACAGG + Intergenic
1130519827 15:84653973-84653995 AGAGGCTGGCGCAAACTAACTGG + Intronic
1131890497 15:96966856-96966878 AAAGGCTTGCAGAGACTACTTGG + Intergenic
1132008959 15:98257401-98257423 AAAGGCTGGCAGCCACCACCAGG + Intergenic
1136311339 16:29413128-29413150 AAAGTGAGGCTGAAACTACTGGG + Intergenic
1138323841 16:56144084-56144106 AAAGGCTAGGTGAAATTACATGG - Intergenic
1140840556 16:78834537-78834559 GAAGGCTGGCAGAAAGGACCAGG + Intronic
1141925851 16:87168914-87168936 AAAGAGTTGCTGAAACTACTGGG - Intronic
1142961379 17:3554385-3554407 AAATGCTGGCTGGAAGTTCCAGG - Intronic
1146065059 17:29628190-29628212 AAAGGCTGGCACAAACTCCTTGG + Exonic
1146735368 17:35233893-35233915 AAAGGCTGGCTGATGTTAACTGG + Intergenic
1147767122 17:42844708-42844730 GGAGGCTGGCTGGAACCACCTGG - Exonic
1151096193 17:71501971-71501993 AGAGCCTGGGTGAAACTGCCTGG + Intergenic
1155865079 18:30954944-30954966 AAAGACTGCCAGCAACTACCAGG - Intergenic
1155946418 18:31857175-31857197 AAAGGATGACTGAGACGACCAGG + Intronic
1156743533 18:40361727-40361749 AAAGTTTGGGTGAAACTACAGGG + Intergenic
1158040837 18:53091222-53091244 AAAAGCTAGCTGAAACTGCTTGG - Intronic
1158947291 18:62458047-62458069 AAAGGCTGGCTCAAACTGGGTGG - Intergenic
1159431849 18:68362612-68362634 AAAGCCTGGCTAAAAGTCCCAGG + Intergenic
1161770350 19:6227505-6227527 AAAGGCAGGCAGCAACTTCCCGG + Intronic
1161970785 19:7578784-7578806 GAAGGCTAGCTGAAACAGCCTGG - Intergenic
1164806254 19:31119354-31119376 AAAGGAGGGCTGTTACTACCGGG + Intergenic
1164882565 19:31746008-31746030 GAAGGCTGGCTGCAGCCACCAGG - Intergenic
1165589522 19:36955408-36955430 TAAGACTGGCTGAACCTATCAGG + Intronic
1165752426 19:38268385-38268407 AAAGGCTGTGTGAAGCTTCCTGG - Intronic
925483831 2:4305739-4305761 AAAGGCTGGCTGATGTCACCTGG + Intergenic
927064534 2:19458062-19458084 AAAAGCTGGAGGAAACTCCCAGG + Intergenic
929406482 2:41648643-41648665 AAAGGCAGGCTGGAACTCTCAGG + Intergenic
930577856 2:53173871-53173893 AGAGGCTGGTGGAAACTTCCTGG - Intergenic
932906002 2:75752236-75752258 AAAGCCTGTCTCAAACAACCTGG + Intergenic
933014682 2:77110252-77110274 AAATACTGGCTGAAACTAGTTGG + Intronic
933971874 2:87476389-87476411 AGAGGCTGGCTGAATCTCCTCGG - Intergenic
936779853 2:116019019-116019041 TAATGCTGGCTCAAATTACCTGG - Intergenic
938759015 2:134406895-134406917 AAAGGCTGTCTGAAATACCCAGG + Intronic
938780220 2:134577736-134577758 AAGGGCTGACTGTAAATACCTGG - Intronic
938938615 2:136149140-136149162 AGAGGCTGGCTGATATTAACTGG - Intergenic
939647308 2:144716571-144716593 ATGGGCTGGCTGAAACTCACAGG + Intergenic
942955898 2:181772994-181773016 AAATGTTGGCTGAAACTGTCAGG + Intergenic
943448283 2:188017374-188017396 AAAAGCTGGGTGCAACTACAGGG + Intergenic
944413024 2:199460093-199460115 AAACGCTGCCTAAAACTCCCAGG - Intronic
948629211 2:239291342-239291364 ACAGGCTTGCTGAAAATAGCCGG + Intronic
1169863411 20:10174514-10174536 CAAGACTGGCTGAAACTATTGGG + Intergenic
1170694279 20:18644520-18644542 AAAAGTTGGCTGAGCCTACCTGG - Intronic
1174500720 20:50982112-50982134 AAAGGCTGGCTGCACACACCTGG - Intergenic
1177073766 21:16545940-16545962 AAAGTCTGGCTTATACTACCTGG - Intergenic
1177492933 21:21851759-21851781 AAAAGCTGGCTGTAATTGCCAGG - Intergenic
1179347188 21:40569516-40569538 AAGGGCTGGCTAGAACTCCCAGG - Intronic
1182349335 22:29690247-29690269 AGAGGCTGGCTAAAAGAACCTGG - Intronic
1185183932 22:49381332-49381354 AAAGGCTGACTGAAAGTGTCTGG - Intergenic
950221772 3:11201661-11201683 AAGGGCTGTCTGAAAATTCCAGG + Intronic
953335986 3:42094343-42094365 CAAGTCAGGCTGAAACTATCAGG + Intronic
956287396 3:67625467-67625489 AGATGCTGGCTGGATCTACCTGG - Intronic
958806660 3:98819279-98819301 AAAGCCAGGCTGAAAAAACCTGG - Exonic
961727155 3:128938953-128938975 AAAGCCTTGCTGAAACTCACTGG - Intronic
965603114 3:170473953-170473975 AATTGCTGGCTCAGACTACCAGG - Intronic
966399572 3:179534724-179534746 CAAGGCTGGCTGAATCCAGCTGG - Intergenic
969685661 4:8672620-8672642 AAGGGCTGCCTGAGACTCCCTGG - Intergenic
969948773 4:10812151-10812173 AAATTCTGGCTGCAACTTCCAGG - Intergenic
973247196 4:48022085-48022107 AAAGTCTGGATTAAACTCCCTGG + Intronic
973996002 4:56459727-56459749 AAAGGCTGGCTGAAATATCTTGG - Exonic
977427456 4:96886352-96886374 AAAGGCCCGATGAAGCTACCTGG + Intergenic
979295710 4:119030733-119030755 AAAGGCTGGCTGGGACCACGGGG - Exonic
984771332 4:183438944-183438966 GGACGCTGGCAGAAACTACCAGG + Intergenic
984932612 4:184860368-184860390 AAAAGCTGTCTGAAAATATCAGG - Intergenic
984961306 4:185100710-185100732 AAAGCACAGCTGAAACTACCAGG + Intergenic
987103238 5:14611434-14611456 ACAGGCTGCCTGCAACTCCCTGG - Exonic
988259513 5:28866567-28866589 AAAGGCTGACTCAAACTCCTGGG - Intergenic
988284720 5:29197222-29197244 AAAGGCTGTGTGAAAATACACGG - Intergenic
988839364 5:35068104-35068126 AAAGGCTGGCTGAAACTACCAGG + Intronic
988930690 5:36033270-36033292 AGAGTCTGGCTGAAACAGCCAGG + Intergenic
989134215 5:38136779-38136801 AGATGCTGGCTGATTCTACCCGG - Intergenic
989656457 5:43750128-43750150 GAAAGCTGTCAGAAACTACCAGG - Intergenic
994673470 5:102791814-102791836 ACAGGCTATGTGAAACTACCTGG - Intronic
997194204 5:131966851-131966873 GATGGCTGGCTGATTCTACCAGG + Intronic
998771854 5:145554714-145554736 AAATGCTGTCTGTAACTGCCTGG - Intronic
1001260100 5:170221020-170221042 AAATGCTGGCTGAATCCACAAGG + Intergenic
1004647092 6:17572904-17572926 AAAAGCTGGCTGAAATAACCAGG + Intergenic
1004734124 6:18387627-18387649 AAAAGCTCGCTAAACCTACCTGG - Exonic
1005393932 6:25362189-25362211 AAAGGCTGTCAGAAACTTTCAGG - Intronic
1005609164 6:27506858-27506880 AAAGTCTGTCTGAATCTACTTGG - Intergenic
1012259516 6:97071546-97071568 AAATGCTGGCTGAACATACAGGG - Intronic
1019117945 6:169780435-169780457 AAATGCTGGTGAAAACTACCTGG + Intronic
1021326158 7:19272396-19272418 ACAAGCTGGCTGAGACTAACTGG + Intergenic
1024255287 7:47536281-47536303 AAAGGGAGGCTGAACCTAGCGGG + Intronic
1024255299 7:47536348-47536370 AAAGGGAGGCTGAACCTAGCGGG + Intronic
1024422097 7:49180364-49180386 AAAGGCTGGAGAAAATTACCAGG + Intergenic
1026454945 7:70563030-70563052 AAAAGTGGGCTGAAACTACAAGG + Intronic
1028220489 7:88190643-88190665 AAAGCCAGGCTGGAACTGCCGGG + Intronic
1030544015 7:110870030-110870052 ACAGGCTGGCTGAAACTAGGAGG - Intronic
1034041607 7:147883181-147883203 TGAGGCTGGCTGAAACTAATTGG - Intronic
1034869140 7:154667994-154668016 AACGGCTGAATAAAACTACCAGG - Intronic
1041761789 8:61375274-61375296 AGAGGCTGGCTGCAACTCCCAGG + Intronic
1045549042 8:103153854-103153876 AAAGGCTTGCAGAAAATAGCAGG + Intronic
1046741743 8:117836522-117836544 GAAGGCTGGTTGCAACTTCCAGG + Intronic
1050237264 9:3595203-3595225 AGAGGCTGGCTGTTACTAACTGG - Intergenic
1056843474 9:90017801-90017823 AGAGGCTGGCTGATGCCACCTGG - Intergenic
1060172648 9:121474502-121474524 AAAGTCTGTCTGACACTACAAGG - Intergenic
1061971240 9:134046537-134046559 AAGGGCTGGCAGAAAGAACCCGG + Intronic
1188031182 X:25265969-25265991 AAAGAGTGGCTGAAAGTACAAGG + Intergenic
1188984039 X:36753651-36753673 TAAGGCTGGCTGAAACTACCTGG + Intergenic
1189672535 X:43426211-43426233 AAGGGCTTGATGAAACAACCTGG + Intergenic
1198152175 X:133922120-133922142 GAAGTCTGGCTGAAACAGCCTGG + Intronic
1200255948 X:154583256-154583278 AGTGGCTGGCTGAGACTTCCAGG + Intergenic
1200261821 X:154621147-154621169 AGTGGCTGGCTGAGACTTCCAGG - Intergenic
1200916886 Y:8579098-8579120 AAAGGCTGGCTGAGACCCACTGG + Intergenic
1200927752 Y:8669789-8669811 GAAGGCTGGCTGATACCTCCTGG + Intergenic