ID: 988840765

View in Genome Browser
Species Human (GRCh38)
Location 5:35081486-35081508
Sequence GCATCGGAGGGCCCCTTCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 44}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988840755_988840765 30 Left 988840755 5:35081433-35081455 CCTGCCATCTGGATAAACCTGCC 0: 1
1: 7
2: 9
3: 12
4: 117
Right 988840765 5:35081486-35081508 GCATCGGAGGGCCCCTTCATAGG 0: 1
1: 0
2: 2
3: 14
4: 44
988840757_988840765 13 Left 988840757 5:35081450-35081472 CCTGCCAAATATGACATCAAAAA 0: 1
1: 0
2: 1
3: 28
4: 357
Right 988840765 5:35081486-35081508 GCATCGGAGGGCCCCTTCATAGG 0: 1
1: 0
2: 2
3: 14
4: 44
988840756_988840765 26 Left 988840756 5:35081437-35081459 CCATCTGGATAAACCTGCCAAAT 0: 1
1: 14
2: 13
3: 24
4: 374
Right 988840765 5:35081486-35081508 GCATCGGAGGGCCCCTTCATAGG 0: 1
1: 0
2: 2
3: 14
4: 44
988840759_988840765 9 Left 988840759 5:35081454-35081476 CCAAATATGACATCAAAAAGGTG 0: 1
1: 0
2: 1
3: 18
4: 179
Right 988840765 5:35081486-35081508 GCATCGGAGGGCCCCTTCATAGG 0: 1
1: 0
2: 2
3: 14
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988840765 Original CRISPR GCATCGGAGGGCCCCTTCAT AGG Intronic