ID: 988840765

View in Genome Browser
Species Human (GRCh38)
Location 5:35081486-35081508
Sequence GCATCGGAGGGCCCCTTCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 44}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988840755_988840765 30 Left 988840755 5:35081433-35081455 CCTGCCATCTGGATAAACCTGCC 0: 1
1: 7
2: 9
3: 12
4: 117
Right 988840765 5:35081486-35081508 GCATCGGAGGGCCCCTTCATAGG 0: 1
1: 0
2: 2
3: 14
4: 44
988840759_988840765 9 Left 988840759 5:35081454-35081476 CCAAATATGACATCAAAAAGGTG 0: 1
1: 0
2: 1
3: 18
4: 179
Right 988840765 5:35081486-35081508 GCATCGGAGGGCCCCTTCATAGG 0: 1
1: 0
2: 2
3: 14
4: 44
988840757_988840765 13 Left 988840757 5:35081450-35081472 CCTGCCAAATATGACATCAAAAA 0: 1
1: 0
2: 1
3: 28
4: 357
Right 988840765 5:35081486-35081508 GCATCGGAGGGCCCCTTCATAGG 0: 1
1: 0
2: 2
3: 14
4: 44
988840756_988840765 26 Left 988840756 5:35081437-35081459 CCATCTGGATAAACCTGCCAAAT 0: 1
1: 14
2: 13
3: 24
4: 374
Right 988840765 5:35081486-35081508 GCATCGGAGGGCCCCTTCATAGG 0: 1
1: 0
2: 2
3: 14
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988840765 Original CRISPR GCATCGGAGGGCCCCTTCAT AGG Intronic
901038443 1:6350049-6350071 GCATCTCAGGGCCCCTTCCGTGG - Intronic
901839595 1:11945487-11945509 GCATGGGAGGTCCCTTGCATGGG + Intronic
904707483 1:32402303-32402325 GCATCGGAGGCCACCCTCAAGGG - Intergenic
907347540 1:53795236-53795258 CCATTGGAGGGCCCCTTTCTTGG + Intronic
913227656 1:116714026-116714048 GCATCAGAGGGCCCCCTCAAGGG - Intergenic
913507767 1:119533943-119533965 GCATCGGAGTTCCCCTTCGAGGG - Intergenic
1067183017 10:44004894-44004916 TCAGGGGAGGGTCCCTTCATTGG + Intergenic
1068338347 10:55667540-55667562 GCATCGGAGGGCCCGCTCAAGGG - Intergenic
1077595893 11:3531416-3531438 TCATGGGAGGGCCCCCCCATGGG - Intergenic
1081771077 11:45650920-45650942 GCATGGCTGGGCACCTTCATGGG + Exonic
1082763134 11:57145699-57145721 GCAGCGGCGGGCCCCATCCTGGG + Intergenic
1084176125 11:67423285-67423307 GCCTAGGATGGCCCCTTCAGGGG - Intronic
1086581794 11:88408371-88408393 GCATCAGAAGGCCCCTTCAAGGG - Intergenic
1090848022 11:130546644-130546666 GCTGCGGAGGGCCCCTGCGTGGG - Intergenic
1092193928 12:6537851-6537873 GCGTCGGAGGGCCCCCTCAAGGG + Exonic
1093562074 12:20553049-20553071 GTGTCGGAGGGCTCGTTCATCGG + Intronic
1094855235 12:34399949-34399971 GCATCAGAGGTCCCCTGCAACGG + Intergenic
1098331425 12:69357659-69357681 GCAGCAGAGGGCCACTACATAGG + Intergenic
1103741728 12:123095853-123095875 GCACCTGAGGCTCCCTTCATGGG + Intronic
1103955488 12:124574168-124574190 GCACAGGAGGGCCCCATCAAGGG + Intergenic
1105547122 13:21359103-21359125 GTATCGGAGGGCCCCCTCAAGGG + Intergenic
1119870193 14:78010485-78010507 GCATGGGGAGGCCCATTCATTGG + Intergenic
1122967122 14:105136576-105136598 GCACCGAAGGGCACCTGCATTGG + Intergenic
1129992680 15:79978407-79978429 GAATCTGAGCTCCCCTTCATGGG - Intergenic
1131872877 15:96779356-96779378 TCTTTGGAGGGCCCTTTCATTGG + Intergenic
1133130368 16:3672959-3672981 GCATCGTGGGGCCCCTGCACTGG - Intronic
1133596821 16:7301990-7302012 GCATCAGAGGTCACATTCATGGG - Intronic
1142180951 16:88669858-88669880 ACATGGGTGGGCCCCTTCAGAGG - Intergenic
1148189531 17:45668831-45668853 GCATCCTAGGTCCCCTTCCTAGG + Intergenic
1150314958 17:64161146-64161168 GCATCTGAGGACCCATTCACAGG + Intronic
1151774422 17:76189743-76189765 GCTTCGGAGGGTCCCTTCTCCGG - Intronic
1152605566 17:81287942-81287964 GCCTGGGCGGGCCCCTTCCTGGG - Intronic
1160161885 18:76479713-76479735 GCAACAGAGGGCCCCTGTATTGG - Intronic
1161559074 19:4960841-4960863 GTGTCGGAGGGCTCGTTCATCGG + Exonic
1166969919 19:46559427-46559449 GCATTGGAGGACCCCCTCAAGGG + Intronic
925418164 2:3688176-3688198 GCATTGGAGGGCCCCCTCAAGGG - Intronic
926891011 2:17638853-17638875 GCATAGGAGGGCCCCTTCCCAGG + Intronic
947563421 2:231177797-231177819 TCATCTGAGGATCCCTTCATGGG + Intergenic
947637775 2:231688773-231688795 CCATCGTAGGGCCCCTTGCTAGG + Intergenic
947931489 2:233968560-233968582 GCTTCTGAGGGCCCCTGCCTAGG - Intronic
1172136497 20:32690028-32690050 GCTTCGGAGGGCCCCTGTGTGGG - Intergenic
1172567369 20:35941043-35941065 GGATGGTAGGGCTCCTTCATTGG + Exonic
1178096708 21:29223070-29223092 GCATTGGAGGGCCCCTTCAAGGG + Intronic
970379518 4:15492917-15492939 GCATCAGAGGGCCCCCTCAAGGG - Intronic
976628051 4:87207877-87207899 ACATCGGAGGGCCCCCTCAAGGG + Intronic
988840765 5:35081486-35081508 GCATCGGAGGGCCCCTTCATAGG + Intronic
1001984575 5:176061961-176061983 GCCTCGGAGGGCACCCTCAGAGG + Exonic
1002263052 5:178007583-178007605 GCCTCGGAGGGCACCCTCAGAGG + Intronic
1003404557 6:5817610-5817632 GTATTGGAGGGCCCCCTCAAGGG - Intergenic
1006358342 6:33573651-33573673 GCTTCGGAGGGCCCCTGCGTGGG - Exonic
1006393652 6:33773282-33773304 ACAACGGAGGGCCCCTTCAGTGG + Intronic
1009895737 6:69746636-69746658 GCATTGGAGGGTCCCTTCAAAGG + Intronic
1010781829 6:79953198-79953220 GCATCAGAGGGCCCCCTCAAAGG - Intergenic
1020551778 7:9615770-9615792 GCATCAGAGGGCTCCCTCAAGGG + Intergenic
1022032626 7:26506234-26506256 GCACAGGATGGGCCCTTCATAGG + Intergenic
1037998164 8:23368373-23368395 GCTGCGCAGGGCCCCTTCGTGGG - Exonic
1041717356 8:60944271-60944293 GCAGCTGTGGGCCCCTCCATAGG - Intergenic
1041844207 8:62308608-62308630 GCATGGAAGGTCACCTTCATGGG + Intronic
1058976047 9:110126546-110126568 GCCTCCGAGGGCTCCTTGATAGG + Intronic
1061424218 9:130489077-130489099 GCGTCTGAGGGCCCCTTCAAAGG + Intronic
1189276114 X:39787325-39787347 GCATCGGAGGGCCCCCTCAAGGG - Intergenic