ID: 988842816

View in Genome Browser
Species Human (GRCh38)
Location 5:35099458-35099480
Sequence CTTGATAATAACTATGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 2, 1: 5, 2: 6, 3: 37, 4: 188}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988842816 Original CRISPR CTTGATAATAACTATGTTAC TGG Intronic
906994921 1:50782101-50782123 AATGATAATACATATGTTACTGG + Intronic
908934246 1:69355683-69355705 AATGATAATAAATATGTTACTGG - Intergenic
909186268 1:72490384-72490406 CTTGATTATGAGTATGTTCCTGG - Intergenic
909771436 1:79427150-79427172 CTTGATAATAATAAGGTAACAGG + Intergenic
910186478 1:84546481-84546503 CTTGATGAAAACTATGATAAAGG + Intergenic
911539278 1:99138965-99138987 CTTGATAATAAATGTATTACTGG + Intergenic
912304586 1:108554460-108554482 GTTGAGAATAACTGGGTTACAGG - Intergenic
912885727 1:113471625-113471647 GATAATAAAAACTATGTTACTGG - Intronic
915267605 1:154730285-154730307 GTTGATAATTACATTGTTACTGG + Intronic
916273847 1:162972273-162972295 CTTGATGAAAACTAGGTTATTGG + Intergenic
916897143 1:169177099-169177121 CTGGATAGTAATTATGTTATAGG - Intronic
917766566 1:178226119-178226141 CTAGATGATAACTATGCTACTGG - Intronic
918692810 1:187503003-187503025 TATGAGAGTAACTATGTTACTGG + Intergenic
919557754 1:199081708-199081730 CTTGAAAATGACTTTGTTTCAGG + Intergenic
920932465 1:210401413-210401435 GTAGATAATAAATATGTTCCTGG - Intronic
921434821 1:215106267-215106289 TTTGATAATAACCATCTGACTGG + Intronic
924166833 1:241292282-241292304 AATGATAATGACTATGTTACTGG - Intronic
924166900 1:241293288-241293310 AATGATAATGACTATGTTACTGG + Intronic
924186606 1:241498222-241498244 CTTCAAAATATCTAAGTTACTGG - Intronic
1063075545 10:2712950-2712972 CTTGAGACTAACTGTGTTCCAGG - Intergenic
1065984625 10:30937473-30937495 CTTTATAATGATTATGTTAAAGG + Intronic
1068632147 10:59309157-59309179 CTTGTTAATAACTTGGTTATTGG - Intronic
1069184163 10:65401703-65401725 CTTGAGAATAAGTGTTTTACTGG + Intergenic
1070038298 10:72749664-72749686 GCTGACAATAAATATGTTACAGG + Intronic
1072325158 10:94290792-94290814 AATAATAATAAATATGTTACTGG - Intronic
1072467098 10:95675023-95675045 ATTGAGAATGAATATGTTACAGG + Intronic
1072831316 10:98661685-98661707 CTAGATAAAAATTATGGTACAGG - Intronic
1075469133 10:122674806-122674828 CTTGATTTTAACTACCTTACAGG - Intergenic
1075497802 10:122942215-122942237 CATGATAATAACTCTTTTAATGG - Intronic
1077761789 11:5108330-5108352 CTTTATAATAACTATGCTATAGG - Intergenic
1079199466 11:18363281-18363303 AATGATAATGAATATGTTACTGG - Intronic
1080590028 11:33715151-33715173 TTTTATAATAAATGTGTTACTGG - Intronic
1081326088 11:41746715-41746737 TTTGATAATAACTATTCTAATGG - Intergenic
1086315540 11:85588158-85588180 CCTGATGACAACTATGTGACTGG + Intronic
1087017535 11:93568556-93568578 TTTGGGAATAACAATGTTACTGG - Intergenic
1087061135 11:93978702-93978724 CTTGATTAGAACAATGTTAATGG - Intergenic
1087355319 11:97086263-97086285 CTTGGTTATAACTACGTTAGAGG + Intergenic
1087544745 11:99570534-99570556 CTTGAAAATTATTATGTAACTGG - Intronic
1087890681 11:103534421-103534443 TTTGATAATAACCATCTGACAGG - Intergenic
1090065937 11:123503454-123503476 CTTTATAATTACTATCTTAGGGG - Intergenic
1090696089 11:129243554-129243576 CTTGATGAGAACTATGTTTTAGG - Intronic
1093775506 12:23069175-23069197 ATTGATAATAGCTATTTTAAAGG - Intergenic
1095826897 12:46539334-46539356 TGAGATAATATCTATGTTACAGG + Intergenic
1098754229 12:74338222-74338244 CTTGAAAATTAATATGTTATTGG + Intergenic
1099020318 12:77395570-77395592 CTTGATTATAACCATGTGGCTGG + Intergenic
1099121772 12:78698799-78698821 AATGATAATAAATATGTTACTGG - Intergenic
1099559708 12:84155811-84155833 TATGATAATAAATATGTTATAGG + Intergenic
1100628544 12:96362547-96362569 TTTGAAAATAACTATATTAGAGG + Intronic
1101198023 12:102405535-102405557 CTTAATAATATCTATTTTGCGGG - Intronic
1101683622 12:106994525-106994547 CTGGCTACAAACTATGTTACAGG + Intronic
1103546043 12:121702362-121702384 CTTTATTATACCTATTTTACAGG - Intergenic
1105575825 13:21650663-21650685 CTTGATAATAACAATGGTGGTGG - Intergenic
1107179822 13:37446202-37446224 TTTCATAATATATATGTTACAGG - Intergenic
1107262126 13:38505511-38505533 GTAAATAATAACTAAGTTACTGG + Intergenic
1108060369 13:46527027-46527049 CTTCATAATAACTATGTCATTGG + Intergenic
1108233697 13:48378653-48378675 CTTAATAATGAACATGTTACTGG - Intronic
1108812442 13:54244908-54244930 AATGATAATAACTGTGTTACTGG - Intergenic
1109058199 13:57580227-57580249 CTTTATAATATCTATTTTTCTGG + Intergenic
1109067198 13:57712125-57712147 CTTTAAAATAAATATGTTACTGG + Intronic
1109223686 13:59667100-59667122 CCTGATAATAACCACGTGACAGG - Intronic
1109656436 13:65396958-65396980 CTTGAAAATAAATATCTAACTGG - Intergenic
1110994921 13:82095466-82095488 AATGATAACAACTATGTTACTGG - Intergenic
1111747532 13:92289590-92289612 GTTAATAATAACTATGTATCAGG + Intronic
1111797751 13:92945111-92945133 ATAGAAAATAACAATGTTACTGG - Intergenic
1115375460 14:32670564-32670586 TTTGGTAATAATTTTGTTACTGG - Intronic
1115819618 14:37199855-37199877 CTAGAAAATTACTGTGTTACAGG + Intronic
1117745681 14:58867048-58867070 CTTGATACAAACTATTTTACTGG - Intergenic
1118489024 14:66241416-66241438 CCTGATAATAATTAAGTTCCAGG + Intergenic
1119048279 14:71340469-71340491 GTTGATAATACCTATTTTTCAGG - Intronic
1120282947 14:82462682-82462704 TTTGATAATAGCTATCTTAATGG - Intergenic
1121998213 14:98623262-98623284 CTTGACCATAACTAGTTTACAGG - Intergenic
1122759376 14:104010678-104010700 AATGATAGTAACTATGTTACTGG - Intronic
1124018527 15:25899091-25899113 CTTGAGAAAGACTATGTTACTGG + Intergenic
1124449173 15:29769823-29769845 CTTGATAATGACTATGTTACTGG + Intronic
1125582943 15:40800025-40800047 CTTCATAATAGCTATCTTAATGG + Intronic
1131494271 15:92891402-92891424 CTTGATAATAAAAATGTATCCGG - Intronic
1141557804 16:84847349-84847371 TTTTATAAAAACTATCTTACAGG + Intronic
1150023751 17:61649601-61649623 CATGATAATAATTATGTTAAAGG + Intergenic
1150029152 17:61713228-61713250 AATGATAATAACTGTGTTACTGG + Intronic
1150953131 17:69824441-69824463 CTAGAGAATAACTATGCTGCTGG - Intergenic
1152056263 17:78030076-78030098 GTTCATAATAACTATATTACTGG - Intronic
1153520186 18:5944531-5944553 CTTGGTCATAAATATTTTACTGG - Intergenic
1155370394 18:25093731-25093753 CTTGATTATAATTATGTAAGAGG + Intronic
1155622188 18:27792525-27792547 CTTTATAAAAACTATCTTAAAGG - Intergenic
1156037187 18:32777832-32777854 CTTGATAATTGCTCTGATACGGG + Intergenic
1156796790 18:41055467-41055489 CATTATAATAATTATGTTTCAGG - Intergenic
1159142332 18:64412974-64412996 CATAATAATAATTATGTTAATGG + Intergenic
1159253442 18:65912333-65912355 CTTTAAAATAATTATGTTACAGG - Intergenic
1162912996 19:13859829-13859851 ATTAATAATCACTATGTTCCTGG - Intergenic
1165249824 19:34520982-34521004 CTTGATGATAACTCTGTCACTGG - Intergenic
1165586399 19:36919905-36919927 AATGATAATAAATATGTTACTGG + Intronic
925464277 2:4092347-4092369 TTTGATAATAACTATTCTAATGG + Intergenic
926098489 2:10098178-10098200 CTTAATAACATCTATGGTACTGG + Intergenic
928220086 2:29396210-29396232 CTGGATAATAACGCTGTTGCAGG + Intronic
928748683 2:34445952-34445974 CTGGATTATCACTATGTTCCAGG + Intergenic
931423098 2:62146205-62146227 CTTGATAATAAGTGTGTTACTGG + Intronic
931448701 2:62349437-62349459 CTTAATTATAACTATATTTCTGG - Intergenic
937777307 2:125793767-125793789 GTTTATAATACCTATGTTATAGG + Intergenic
939292205 2:140211293-140211315 TTTGACAAAAATTATGTTACTGG + Intergenic
940697591 2:156998913-156998935 AATGATAATAAATATGTAACTGG - Intergenic
941878367 2:170458088-170458110 ATAGTAAATAACTATGTTACTGG - Intronic
943065490 2:183081776-183081798 CTTGATAATACCAAGCTTACAGG - Intronic
943265167 2:185721256-185721278 ATAATTAATAACTATGTTACTGG + Intergenic
945752154 2:213801140-213801162 TTTGACAATAACTATTTTCCAGG - Intronic
946124959 2:217554487-217554509 CTTGAAAGTAACTCTGATACAGG + Intronic
946453969 2:219806432-219806454 TTTGATAATAGCTATTTTAATGG + Intergenic
946568386 2:220993687-220993709 CTTAATAATAACTTTCTTAGAGG - Intergenic
946741724 2:222808933-222808955 CTTGATGATATATATATTACTGG - Intergenic
1169057869 20:2638410-2638432 AATGATAATAATTATGTTACTGG + Intronic
1170339068 20:15302958-15302980 CTTCATAATAACTTTGTAAAGGG - Intronic
1177478606 21:21656693-21656715 CTTTATGAGAACTATGTTATTGG - Intergenic
1178556384 21:33594121-33594143 CTTAATAATTACAATGTTATTGG + Intronic
1181340137 22:22172338-22172360 CTTGGGGATAACTTTGTTACAGG - Intergenic
950252399 3:11477050-11477072 CTTGATTATAATTATTTAACTGG + Intronic
951838740 3:27010756-27010778 CTTAATACTTACTATGTTCCAGG - Intergenic
953043506 3:39275539-39275561 CTTGATAACATGTATGTAACAGG + Intronic
954975830 3:54693479-54693501 CTTGATGATAACTATGTTACTGG + Intronic
956119941 3:65956221-65956243 TTTGATAATAACTATGGGCCAGG + Intronic
957515690 3:81247959-81247981 CTTGATAATAACTATGTTACTGG + Intergenic
958773344 3:98452562-98452584 CTTGATAATAAGTTGGATACAGG + Intergenic
959624794 3:108437823-108437845 TTTGGAAATATCTATGTTACTGG - Intronic
960129438 3:114039134-114039156 GATAATAACAACTATGTTACTGG + Intronic
960458796 3:117907223-117907245 AATGATAACAACTATGTTACTGG + Intergenic
961902723 3:130229087-130229109 TTTGATAAAAACTATTTAACTGG + Intergenic
963864800 3:150349146-150349168 CTTTTTAAGCACTATGTTACAGG - Intergenic
963875671 3:150471775-150471797 AATGATAATAACCATGTTACTGG - Intergenic
965469180 3:169069341-169069363 ATTGATTAAAACTGTGTTACTGG + Intergenic
967456530 3:189693046-189693068 CAGGAGAATAACTATGTTACAGG + Intronic
969885919 4:10215330-10215352 CTTGAGAATCACTATGTGCCTGG + Intergenic
970533301 4:17003937-17003959 CTTGATAGCACCTTTGTTACCGG - Intergenic
970550981 4:17180937-17180959 ATAAAAAATAACTATGTTACTGG + Intergenic
970892937 4:21067875-21067897 CTTGATAATATTTATGTTGATGG - Intronic
975774927 4:77775874-77775896 ATATATAATAACTGTGTTACAGG - Intronic
977944016 4:102890241-102890263 TTTGTTAATAAGTAAGTTACAGG + Intronic
979430855 4:120628664-120628686 TTTGATAATAACTATCTTAATGG - Intergenic
979956974 4:126965907-126965929 CTTGTTCATAACTATCATACAGG + Intergenic
980326994 4:131358837-131358859 CTTTAACATAAATATGTTACAGG - Intergenic
980539391 4:134174356-134174378 CTTGATAATAAATATGTTACTGG - Intergenic
981173868 4:141657896-141657918 CTTGATTATAACTATGTTGCTGG - Intronic
982223841 4:153147828-153147850 CTTGAAAATAACCATGAGACTGG + Intergenic
982252188 4:153418187-153418209 AATGATAATGACGATGTTACTGG - Intergenic
983003874 4:162457865-162457887 CATGATGATAATTATGTTATCGG - Intergenic
985097239 4:186425217-186425239 GTTAATAATGACTATGTAACTGG - Intergenic
985263058 4:188132694-188132716 TTTGATAATAGCCATGTAACAGG + Intergenic
987070434 5:14332212-14332234 CTGGATAATAACTTTGTGACAGG - Intronic
988234587 5:28524883-28524905 TTTGATAATGACTATGATTCCGG - Intergenic
988278320 5:29112693-29112715 CTTTATAATATCTATTTTTCTGG + Intergenic
988407886 5:30847718-30847740 CTTGATCAAAACTAATTTACCGG - Intergenic
988822251 5:34898854-34898876 CTTAATAGTAACTGTGTTTCTGG + Intronic
988842816 5:35099458-35099480 CTTGATAATAACTATGTTACTGG + Intronic
989081999 5:37632267-37632289 CTTGATAATAAATGACTTACTGG + Intronic
989423682 5:41270723-41270745 CTTGATAAACAGTATCTTACAGG - Intergenic
989817829 5:45757780-45757802 TTTGATAATTAATATGCTACTGG - Intergenic
990002172 5:50907183-50907205 CTTGATAAGAACAGTTTTACTGG + Intergenic
990190273 5:53251816-53251838 AATGATAATAACTATATTACTGG - Intergenic
990229200 5:53692584-53692606 GATAATGATAACTATGTTACTGG - Intergenic
990666142 5:58074292-58074314 CTAGCTAATAATTATGCTACTGG - Intergenic
990813944 5:59761839-59761861 CTTAATAATAACTATGTTGCTGG - Intronic
991656306 5:68907270-68907292 TTTGATAATAACCATTATACTGG + Intergenic
992588003 5:78261283-78261305 CTTGATAATAACCATCCTAATGG + Intronic
992847578 5:80767366-80767388 CTTCACAATAACCATGTAACAGG - Intronic
993014185 5:82517095-82517117 CTTAATAATAAATTTGTTTCTGG + Intergenic
993237952 5:85339442-85339464 CCTTGTAAGAACTATGTTACTGG + Intergenic
994018783 5:95000262-95000284 AATGATAACAACTAGGTTACTGG + Intronic
994062090 5:95489829-95489851 CTTCAAAATAACTATGTTATAGG + Intronic
995893348 5:116982332-116982354 AATGATAATAAATATTTTACTGG + Intergenic
996676417 5:126180085-126180107 CTTTATATTAAATATGTTAAGGG + Intergenic
999164159 5:149533596-149533618 GGGGAAAATAACTATGTTACTGG - Intronic
1000323655 5:160155527-160155549 CATAAAAATACCTATGTTACAGG - Intergenic
1003996443 6:11545655-11545677 CTTGATAACAACTGTGTTACTGG + Intronic
1005923936 6:30424912-30424934 GATGATAATAAATATGTTACTGG + Intergenic
1008725723 6:54416134-54416156 CATTATAATAACTATGTTAAAGG - Intergenic
1009954436 6:70435679-70435701 TTTGTTAAAAACTGTGTTACAGG - Intronic
1012675658 6:102108223-102108245 CTTGATAGCACCTTTGTTACCGG - Intergenic
1013645061 6:112129266-112129288 CCTGTTAATAACTATGTGCCTGG + Intronic
1014158630 6:118140524-118140546 CTTGATAGTAAACATGTTATTGG + Intronic
1014501949 6:122202634-122202656 GATACTAATAACTATGTTACTGG - Intergenic
1016828282 6:148408048-148408070 TTTGATAATAACTATCCTAATGG + Intronic
1016954811 6:149616335-149616357 TTTGATAATAACCATGTAATTGG - Intronic
1017014548 6:150089492-150089514 CTGGCTAATCTCTATGTTACTGG + Intergenic
1017225648 6:152018342-152018364 ATAGCTAATAAATATGTTACTGG - Intronic
1017655867 6:156629074-156629096 CTTGATAATAAATATGTTACTGG + Intergenic
1018510831 6:164522449-164522471 TTTGATAATCACCATGTGACTGG + Intergenic
1020888113 7:13844863-13844885 CCTGATAATAACTTTATTATCGG - Intergenic
1021002514 7:15350106-15350128 ATTCATAATAACTGTGTTTCTGG + Intronic
1021254540 7:18375010-18375032 CTTGATAATAATTATGTTACTGG + Intronic
1021726914 7:23556163-23556185 TTTGATAATAGCCATTTTACTGG + Intergenic
1021743568 7:23713891-23713913 AATGAAAATAACTATGTCACTGG - Intronic
1023515094 7:40993825-40993847 CTTGATAATCACCACTTTACAGG - Intergenic
1028633971 7:92966626-92966648 CTTGATAAAAATTATGTTGGAGG + Intergenic
1030567265 7:111174237-111174259 ATTGAGATTAACTATGTTAAAGG - Intronic
1030707639 7:112711071-112711093 CATGATAATGAATATGTTACTGG + Intergenic
1030981950 7:116196564-116196586 AATGATAATAACTATGTTACTGG - Intergenic
1031273709 7:119689523-119689545 CATGATCAGAACTATGTTGCTGG + Intergenic
1031511243 7:122652933-122652955 GTTGATAATTAATATGTTACTGG + Intronic
1031891934 7:127304582-127304604 AACGATAATAAATATGTTACTGG + Intergenic
1032123204 7:129171684-129171706 CTTCATAATAAATATGTGCCTGG - Intergenic
1033480614 7:141736654-141736676 ATTAATAATGACTATGTCACTGG + Intergenic
1035820737 8:2589079-2589101 CTTGAAAACAACTTTGTAACGGG + Intergenic
1036011172 8:4726341-4726363 GGTGATAATAACTATCTTTCAGG - Intronic
1037195848 8:16188392-16188414 GATGATATGAACTATGTTACAGG - Intronic
1037216935 8:16465942-16465964 CTTGATATTAACTATATGACAGG - Intronic
1037505146 8:19522139-19522161 TTTCATATTAACTCTGTTACAGG - Intronic
1038149118 8:24927022-24927044 CTTAATAATCACCATGTTCCTGG + Intergenic
1038596175 8:28888817-28888839 CTTGATAATCATTGTGCTACAGG - Intronic
1041810568 8:61904131-61904153 CTTGAAAATATGTATGTTATGGG - Intergenic
1043669885 8:82870472-82870494 AATGATAATAAATAAGTTACTGG + Intergenic
1044957966 8:97501537-97501559 GATAATAACAACTATGTTACTGG - Intergenic
1045274058 8:100685801-100685823 CTTTATAATTACTATGTTGTAGG - Intronic
1046224786 8:111263606-111263628 CTTTATAATAGTTATGTTCCAGG + Intergenic
1049127175 8:140802011-140802033 CTGGATAATGACTATGTTACTGG + Intronic
1050035117 9:1427150-1427172 CTTGATAACAACTATGGTTTGGG - Intergenic
1050310485 9:4347818-4347840 CTTGAACACAACTATTTTACTGG + Intronic
1052427545 9:28324947-28324969 CCTGGTACTGACTATGTTACTGG - Intronic
1055334355 9:75218065-75218087 CCTGAAAATAACTATCTTAATGG + Intergenic
1055832183 9:80393215-80393237 GATAATAAGAACTATGTTACTGG - Intergenic
1057110380 9:92464339-92464361 CTTGGTAATGATTATGTCACAGG + Intronic
1058736430 9:107898430-107898452 ATTGATAATATCTATGTAACAGG + Intergenic
1058847583 9:108976501-108976523 CTTCAAAATAACTATGTCAAAGG + Intronic
1059951504 9:119467414-119467436 AATGATAATAAATATGTTACTGG + Intergenic
1060021171 9:120132593-120132615 CATAATAATAACAATGTAACAGG + Intergenic
1188057177 X:25554698-25554720 CTTTATAATAACTCTCTTCCAGG - Intergenic
1188455314 X:30357659-30357681 CTTGGTATTAAGTAGGTTACTGG + Intergenic
1188490274 X:30731881-30731903 CTTGATAATATCTATCTCATAGG + Intergenic
1188510482 X:30930911-30930933 ATTGATAATAACTACTTTTCAGG + Intronic
1188614808 X:32144410-32144432 CTTGATAATGTCTCTGTAACAGG - Intronic
1190137546 X:47810528-47810550 ATTTATAATAAATATGTTATTGG - Intergenic
1193371536 X:80703899-80703921 CTTGATTATCACTATTTTATTGG - Intronic
1194648052 X:96482488-96482510 TTTGTTCATAAATATGTTACTGG + Intergenic
1195387930 X:104330626-104330648 CTTGATAATAACTCTTTTCCAGG + Intergenic
1195635717 X:107113604-107113626 ATTAATAGTAGCTATGTTACAGG - Intronic
1196568669 X:117239654-117239676 CTTGATAAAAACCATTTTACTGG + Intergenic
1196576729 X:117326847-117326869 CTTTATTATAACTCTCTTACAGG + Intergenic
1198335892 X:135666310-135666332 CTTGATAATTGCTATTTTCCTGG + Intergenic
1200824739 Y:7626169-7626191 CTTGGTAATAATAATTTTACTGG - Intergenic
1202235316 Y:22704918-22704940 CTTGGTAATAATAATTTTACTGG + Intergenic
1202307843 Y:23491250-23491272 CTTGGTAATAATAATTTTACTGG - Intergenic
1202562958 Y:26179336-26179358 CTTGGTAATAATAATTTTACTGG + Intergenic