ID: 988843255

View in Genome Browser
Species Human (GRCh38)
Location 5:35103965-35103987
Sequence CTGTGTAAGTGCATGTGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 189}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988843253_988843255 9 Left 988843253 5:35103933-35103955 CCTATTATAATATTTTCCTTTTT 0: 1
1: 0
2: 20
3: 211
4: 1982
Right 988843255 5:35103965-35103987 CTGTGTAAGTGCATGTGCCCAGG 0: 1
1: 0
2: 0
3: 13
4: 189
988843252_988843255 19 Left 988843252 5:35103923-35103945 CCTAAAAGATCCTATTATAATAT 0: 1
1: 0
2: 0
3: 37
4: 447
Right 988843255 5:35103965-35103987 CTGTGTAAGTGCATGTGCCCAGG 0: 1
1: 0
2: 0
3: 13
4: 189
988843254_988843255 -7 Left 988843254 5:35103949-35103971 CCTTTTTTTTTTAAAGCTGTGTA 0: 1
1: 1
2: 10
3: 154
4: 1091
Right 988843255 5:35103965-35103987 CTGTGTAAGTGCATGTGCCCAGG 0: 1
1: 0
2: 0
3: 13
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988843255 Original CRISPR CTGTGTAAGTGCATGTGCCC AGG Intronic
900143175 1:1147001-1147023 CTCTGCAAGTGCAAGTGGCCAGG - Intergenic
900697035 1:4018972-4018994 ATGTGGACGTGGATGTGCCCCGG - Intergenic
900983859 1:6061660-6061682 CTGTATCAGTGCATGTTACCTGG - Intronic
901923329 1:12551040-12551062 CCGTGTTACTGCATGTGGCCGGG + Intergenic
902538334 1:17134772-17134794 GTGTGTAAGTGTGTGTGCACAGG - Intergenic
902843007 1:19087227-19087249 CTGTGAAAGGGCAGGTGCCTGGG - Intronic
904894485 1:33803953-33803975 CTATGTAAGTGCATGGGCTTTGG + Intronic
905296010 1:36954908-36954930 GTGTGAACGTGCATGTGCACAGG - Intronic
907569048 1:55466222-55466244 GTGTGGAAGTGCAGGTGGCCAGG + Intergenic
908818150 1:68055055-68055077 CTGTATCAGTGCCTGTCCCCTGG - Intergenic
915560705 1:156685753-156685775 ATGGGCATGTGCATGTGCCCAGG - Intergenic
916559967 1:165926200-165926222 GTGTGTATGTGCATGTGTCAGGG + Intergenic
916704941 1:167339618-167339640 CTGTGTCAGTGCATGAACCCAGG - Intronic
916962581 1:169904206-169904228 CTGTGTACGAGCATGTACACAGG + Intergenic
917366979 1:174242616-174242638 CTATGTCAGTTCTTGTGCCCTGG + Intronic
919392263 1:197001846-197001868 CACTGTAAGGGCATGAGCCCAGG + Intronic
920212144 1:204335953-204335975 TTATGTAGGGGCATGTGCCCTGG - Intronic
924773448 1:247097128-247097150 CTGTGTCACTGCATCTGCTCTGG - Intergenic
1063215236 10:3919176-3919198 CTGCTTAAGTGCTTGAGCCCGGG - Intergenic
1063924332 10:10962493-10962515 CTGGGTAAGTGCTTGAGGCCAGG + Intergenic
1065761262 10:28985298-28985320 CTGTGTGACTGGATGTGCCTTGG + Intergenic
1066482899 10:35814084-35814106 GTGTGTATGTGCATGTGTTCGGG - Intergenic
1067523134 10:47022781-47022803 CTGTCTGAGTGCAGGTGCCCTGG + Intergenic
1070547238 10:77462562-77462584 GTGTGTAAGTGCATGTGTGAGGG - Intronic
1070549130 10:77476673-77476695 CTGCTCAGGTGCATGTGCCCAGG + Intronic
1070991058 10:80732547-80732569 CTGTGGAAGTGCCTGTTTCCTGG - Intergenic
1072314368 10:94187721-94187743 CCTTGTAAGTCCATGTGCCAGGG - Intronic
1073217063 10:101842307-101842329 CTGTGCATGTGCATGTTCCTGGG - Intronic
1074772991 10:116745313-116745335 CTGTGGAAAGGCATGAGCCCTGG - Intergenic
1076435766 10:130440272-130440294 TTGTGTAATTGCCTGTGGCCTGG + Intergenic
1076509069 10:130999416-130999438 CTGGGCATGGGCATGTGCCCAGG - Intergenic
1076901375 10:133340114-133340136 CTGTGCAGGGGCAGGTGCCCTGG + Intronic
1077155994 11:1091296-1091318 CTGTGTAACTGTGTGTGCCTGGG - Intergenic
1077156008 11:1091601-1091623 CTGTGTAACTGTGTGTGCCTGGG - Intergenic
1078605368 11:12770390-12770412 CTGTGGCAGTGGATGAGCCCTGG + Intronic
1080419794 11:32099651-32099673 CTGGGTTGGTGCATCTGCCCAGG - Intronic
1080581983 11:33651684-33651706 CTGTGCATGTGCATTTACCCAGG - Intronic
1081696111 11:45110294-45110316 CTCTGTAAGGGCATGTACTCAGG - Intronic
1087021085 11:93604071-93604093 CTCTGTAAGTGCATTTGCAAGGG + Intergenic
1089131010 11:116211976-116211998 CTGTGAGGGTGCATGTGCACTGG - Intergenic
1089564767 11:119364704-119364726 CTGTGGAGGTCAATGTGCCCAGG + Intronic
1091803228 12:3338284-3338306 CTGTGAGTGTGCAGGTGCCCAGG - Intergenic
1091938120 12:4449768-4449790 CTGTGTAAGTGGGTGAGGCCTGG - Intergenic
1093227101 12:16498318-16498340 CTGAGTAAATGCATGTTCACTGG - Intronic
1095858413 12:46887477-46887499 CTGTGAAAGTTCATGTGCAGGGG + Intergenic
1095943918 12:47743335-47743357 GTGTGTAAGAGCATGAGCTCTGG - Intronic
1096747978 12:53740898-53740920 CTGTGTATCTGCATGTGTGCAGG + Intergenic
1097242767 12:57587302-57587324 TTGTGTAGGTGCATGTGGGCAGG - Intergenic
1098527868 12:71507429-71507451 CTGTGTCTGTGCATGTGTCTGGG + Intronic
1099317438 12:81102412-81102434 CTGTGCATGTGCATGGGCGCAGG + Intronic
1101215080 12:102573148-102573170 CTGGGGAAGTGCATGTGCTCAGG + Intergenic
1101275630 12:103198074-103198096 CTGTGTGTGTGTATGTGCACAGG - Intergenic
1102017685 12:109658640-109658662 CTGTGTATGTGTGTGTGCACAGG + Intergenic
1103516494 12:121511828-121511850 GTGTGCCAGTGCCTGTGCCCAGG - Intronic
1104245631 12:127038384-127038406 CTGTGGCAGTACATGTGACCAGG + Intergenic
1104760988 12:131297456-131297478 CCGTGGGAGTGCAGGTGCCCAGG + Intergenic
1104818790 12:131663336-131663358 CCGTGGGAGTGCAGGTGCCCAGG - Intergenic
1105736172 13:23273801-23273823 CAGTTTCAGTGAATGTGCCCCGG + Intronic
1106408669 13:29496152-29496174 CAGTGCAGGTGCATCTGCCCTGG + Intronic
1107807260 13:44165202-44165224 CTGTGTAAGTGTATGTGTTGGGG - Intergenic
1110302977 13:73950988-73951010 CTGTGTCCAAGCATGTGCCCAGG - Intronic
1112887366 13:104191157-104191179 CTGGTTAAGTGCATGTCCTCTGG - Intergenic
1113186144 13:107687491-107687513 GTGTGTGTGTGCATGTGCACTGG - Intronic
1113870564 13:113557210-113557232 ATGTGTAAGTGCACATGCACAGG + Intergenic
1113896097 13:113765467-113765489 ATGTGTAAGTGCGTGTGTGCAGG - Intronic
1114614077 14:24059186-24059208 CTGTGTGAGTGCCTGGGCCTGGG + Exonic
1115858067 14:37652811-37652833 CTAGGAAAGTGCATGTGCCATGG - Intronic
1120061657 14:79990481-79990503 CTGTGTACTTGAATTTGCCCAGG + Intergenic
1120454276 14:84712262-84712284 CTGTCTCACTGCATGTGTCCAGG + Intergenic
1121730963 14:96186933-96186955 CTGTGTTGGTGCGTGTGCGCTGG + Intergenic
1121741019 14:96252439-96252461 CTGGGTCTGTGCATGTGCCCTGG + Intronic
1124627305 15:31315668-31315690 ATGTGTGAGTGCCCGTGCCCAGG + Intergenic
1126418260 15:48441787-48441809 CAGTGTTACTGCATGTGCCCAGG + Exonic
1129156418 15:73721169-73721191 CTGTGTAAGTGCAGGTGAGGTGG - Intergenic
1134077009 16:11299128-11299150 CTGTGAACATGCATGTTCCCAGG + Intronic
1137271531 16:46905573-46905595 CTGTGGAAGTGCATGGGGGCTGG - Intronic
1141871122 16:86786823-86786845 ATGTCTGATTGCATGTGCCCAGG + Intergenic
1143572869 17:7771478-7771500 CTGTGTCAGGGCAGGAGCCCTGG - Intronic
1144761512 17:17710127-17710149 GTGTGAAAGTGCACGTGACCAGG - Intronic
1146565527 17:33909605-33909627 CTGCCTAGGTACATGTGCCCTGG + Intronic
1146633978 17:34490745-34490767 CTGAGGATGGGCATGTGCCCAGG - Intergenic
1146681712 17:34813155-34813177 GTGTGTTCGTGCATGTGCACAGG - Intergenic
1146915759 17:36677340-36677362 CTGTGTGAGTCCCTATGCCCGGG - Intergenic
1148023870 17:44571929-44571951 TTATATAAGTGCATGTGACCTGG + Intergenic
1151212297 17:72553712-72553734 ATGTGTGAGTGTGTGTGCCCAGG - Intergenic
1152205211 17:78971016-78971038 GTGTGTGATTGCATGTGCACAGG - Intergenic
1153818592 18:8812682-8812704 CTGTGTAACTGCTTGTGGGCAGG - Intronic
1154327207 18:13400217-13400239 CTGTGCAAGTGTATGTGACATGG - Intronic
1156008257 18:32469345-32469367 CTGTGGAAGTACACGGGCCCAGG - Intronic
1157282356 18:46354369-46354391 CTGAGTGTGTGCATGGGCCCTGG - Intronic
1157488688 18:48107453-48107475 CTGTGTTAGTGCCTGTCCCCTGG - Intronic
1157780151 18:50431060-50431082 CTCTGCAAGTGCATGCTCCCAGG + Intergenic
1160559761 18:79748931-79748953 CCGTGTTGGTGCATGTGCACAGG + Intronic
1161160162 19:2757318-2757340 CTGCGTGAGTGCATGGGGCCGGG - Exonic
1163990661 19:20996335-20996357 CTGTGGAAGTGCATGAGCTCTGG + Intergenic
1165015894 19:32879789-32879811 CTGTGTGGGTGCCTGTGGCCAGG - Intronic
1165192156 19:34073905-34073927 GTGTGTATGTGCATGTGTGCGGG + Intergenic
1167078993 19:47266528-47266550 CTGAGCAAGTGGATGTGCCTCGG + Intronic
1168078735 19:53994016-53994038 CTCTGGAAGTGCCTGTGCCCTGG + Intronic
925061132 2:891026-891048 CTGACTCAGTGCTTGTGCCCTGG - Intergenic
926073317 2:9919226-9919248 CTTTGGATGTACATGTGCCCTGG - Intronic
926075332 2:9938178-9938200 CCGTGTCAGTGCAGGTGCCTGGG - Intergenic
926225716 2:10965535-10965557 CTGGGTAAGGGCATCTGCCAAGG + Intergenic
928315480 2:30241217-30241239 GTGTGTTAGTGGATGTGCGCTGG - Intronic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
932389728 2:71376113-71376135 CAGTGTAAGTCCAAGAGCCCAGG + Intronic
932689340 2:73899103-73899125 CTGTGAAAGTTCTTGTGGCCGGG - Intronic
934913719 2:98280988-98281010 CTGTTAAAGTGCAAATGCCCTGG + Intronic
935300103 2:101686524-101686546 GTGTGTACGTGCGTGTGCGCAGG + Intergenic
936074586 2:109393736-109393758 CTGGGTCAGTGCAGGGGCCCAGG + Intronic
940125120 2:150314107-150314129 TTGGGAGAGTGCATGTGCCCAGG - Intergenic
941260711 2:163293023-163293045 CTCTCCAAGTGCATGTGCCAAGG + Intergenic
942803959 2:179908119-179908141 GTGTGTGTGTGCATGTGCGCGGG + Intergenic
946125298 2:217557466-217557488 CTGGTTAAGTGCAGGTGTCCTGG + Intronic
947310582 2:228797453-228797475 CAGTGTAAGTTCATCTGCGCTGG - Intergenic
948161704 2:235830000-235830022 CTGTGTATGTCCAGGTGTCCTGG - Intronic
948680020 2:239627274-239627296 GTGTGTGTGTGCATGGGCCCTGG + Intergenic
1168815629 20:734688-734710 CTGGAGAACTGCATGTGCCCAGG - Intergenic
1172671010 20:36634471-36634493 CTGAGTAAGTCCATGGGCACTGG - Exonic
1172780649 20:37435091-37435113 CTGTGTGCATGCATGTGCCTGGG + Intergenic
1176290261 21:5040203-5040225 CTGTGCAAACGCGTGTGCCCTGG - Intronic
1179798461 21:43799269-43799291 CTGTGTAGGCACCTGTGCCCTGG + Intronic
1179866994 21:44223438-44223460 CTGTGCAAACGCGTGTGCCCTGG + Intronic
1181546971 22:23607650-23607672 CTGTGGAAATGCATGTTCCCAGG + Intergenic
1182220775 22:28756858-28756880 TTGTGTAAGAGCATGTGTACAGG - Intronic
1184196359 22:42931787-42931809 TTGTGTAAGTGAATATACCCTGG - Intronic
952094735 3:29936363-29936385 CACTGTGAGTACATGTGCCCTGG - Intronic
953267368 3:41404727-41404749 CTGCATATGTGCATGTGCTCAGG + Intronic
953743493 3:45556129-45556151 GTGTGTGTGTGCCTGTGCCCAGG + Intronic
953931520 3:47008187-47008209 GTGTGTGTATGCATGTGCCCTGG + Intronic
954579621 3:51696237-51696259 CTGTGGAAGGGGATGTGCCAGGG + Intronic
954583672 3:51717304-51717326 CTGTGTAAGTGCATGTATGTGGG - Intronic
956301061 3:67773316-67773338 CTGTGTCAGTGCCTTTGCACTGG - Intergenic
956449565 3:69359963-69359985 ATTTGTAAGAGCATGGGCCCTGG - Intronic
962470356 3:135702384-135702406 CTGTGGAATTCTATGTGCCCTGG + Intergenic
964153624 3:153559138-153559160 TTGTGAAAGTGTATGTGTCCAGG - Intergenic
964650730 3:159008592-159008614 CTCTGTAAATGCCTGTACCCAGG + Intronic
966060336 3:175746945-175746967 GTGTGTTAGAGGATGTGCCCAGG - Intronic
966507365 3:180721552-180721574 CTGTGAAAGTGTGAGTGCCCAGG + Intronic
967022816 3:185537493-185537515 CTGGGCAAGTGCATGTTCCCAGG - Intronic
968611987 4:1561508-1561530 CTGTCTAGGTGCATGTGGTCTGG + Intergenic
968816439 4:2824093-2824115 CCGTATAAGTGCACCTGCCCCGG + Intronic
969331792 4:6477849-6477871 CTGTGTGAGTGCATGTCGACAGG - Intronic
969389787 4:6883442-6883464 CCGTGGAAGAGCAAGTGCCCAGG + Exonic
969888618 4:10239129-10239151 CAGTGAAAGTGTATGTGCTCAGG + Intergenic
971137116 4:23881301-23881323 ATGTGTAAATGCAGGTGACCAGG - Intronic
972915179 4:43868410-43868432 TTGAGTCAGTGCATGTACCCTGG - Intergenic
975125603 4:70778948-70778970 CTGTGTAGGGGCATGTTGCCAGG + Intronic
978993781 4:115123438-115123460 CAGTGTTGGTCCATGTGCCCTGG - Intergenic
979288827 4:118957392-118957414 CTGTGTAAGAGTATGTGCTTTGG + Intronic
980294135 4:130888405-130888427 CTGTGTAAGGACAAGTGTCCTGG - Intergenic
983923773 4:173373650-173373672 CTGTGTAAATGCATGTCAACTGG - Intronic
984832346 4:183987359-183987381 GTGTGTAAATGCATGTCCGCAGG + Intronic
985892358 5:2725462-2725484 CTGCGTGAGTGCATGTGGCCGGG - Intergenic
987522472 5:19004809-19004831 CTGGGTAGGTGCAGGTGCACTGG - Intergenic
988843255 5:35103965-35103987 CTGTGTAAGTGCATGTGCCCAGG + Intronic
989693051 5:44168906-44168928 TTGTGTCAGTGCATGTGACATGG + Intergenic
995487329 5:112652113-112652135 CTGGTTAAGAGCATGTGACCTGG - Intergenic
997650225 5:135511805-135511827 GTGGGTAAGTGCTTGTGCCCTGG + Intergenic
998133239 5:139661547-139661569 CTGTGTATGTGCATTCGCCTAGG - Intronic
1001427074 5:171629698-171629720 CTGAGTAAGTGAATGAGCACTGG + Intergenic
1002095880 5:176830540-176830562 GTGTGCATGTGCATGTGTCCTGG + Intronic
1002989759 6:2227811-2227833 CCATGTAAGTGCAGCTGCCCAGG + Intronic
1006622109 6:35372735-35372757 GTGGGTAAGAGCATGTGCTCTGG + Intronic
1006699764 6:35962507-35962529 CTGTGTGAGTGTAGATGCCCTGG - Exonic
1007281803 6:40718402-40718424 CTGTGTTAGTGAATGTTCTCTGG + Intergenic
1013233660 6:108177513-108177535 TTGTGCGTGTGCATGTGCCCAGG - Intronic
1015223826 6:130833854-130833876 CAGGGAAAGTGCATGTGTCCTGG + Intronic
1017982813 6:159417092-159417114 CTGTGGTTGTGCATGTGCGCAGG - Intergenic
1018243621 6:161801779-161801801 CTGTGCAACTGCGTGTGTCCAGG + Intronic
1018952756 6:168389872-168389894 CTGAGGAAGTGCATGTTACCTGG - Intergenic
1019888295 7:3924491-3924513 CAGTGAATGTGCATGTGACCAGG - Intronic
1021160793 7:17270990-17271012 CTTTGTGAGCACATGTGCCCAGG - Intergenic
1024415524 7:49101121-49101143 ATGTGTAAGTGCATGTCACAGGG - Intergenic
1024526353 7:50353248-50353270 CTCTCTAAATGCAAGTGCCCTGG - Intronic
1025086810 7:56030082-56030104 TAGTGTAAGTGCATGTGCTGGGG - Intronic
1028237296 7:88377985-88378007 CTGTGTATGTGTTTGGGCCCTGG - Intergenic
1030820452 7:114086223-114086245 CTGTGTGTGTGAATGTGCGCTGG - Intergenic
1035749435 8:1985436-1985458 CTGTGGAAGAGCATCTCCCCTGG - Intronic
1038283777 8:26189306-26189328 CTGAGTAAGTGTCTGGGCCCTGG + Intergenic
1039479347 8:37860259-37860281 CTGTGATAGTCCAAGTGCCCTGG - Exonic
1042381409 8:68118503-68118525 CTGTAAGAGTGCATCTGCCCAGG - Intronic
1046273692 8:111928821-111928843 CTGTGTAAGTGTATTTATCCTGG - Intergenic
1047132712 8:122038771-122038793 CTGTGTAATTACTTATGCCCTGG + Intergenic
1048671973 8:136732532-136732554 CTGAGAAAGGGCATATGCCCAGG - Intergenic
1049149203 8:141023473-141023495 CTGTGTTAGTCCCGGTGCCCTGG + Intergenic
1049779817 8:144423780-144423802 CTGTGCAAGGGCTAGTGCCCCGG + Exonic
1050481269 9:6089535-6089557 CTGTGTATGTGCATAGGCCTGGG + Intergenic
1051565253 9:18490122-18490144 CTGTTTTACTGCATGTGTCCTGG + Intronic
1052373957 9:27696704-27696726 CTCTGTAAGGGCATGTACCATGG - Intergenic
1052835874 9:33249551-33249573 TTGTGTGAGTGCATGTGTGCAGG - Intronic
1057643830 9:96854331-96854353 CTGTGTCAGTGGATGCGACCGGG - Exonic
1058342158 9:103911727-103911749 GTGTGTAAGTGCAACAGCCCAGG - Intergenic
1058661206 9:107271024-107271046 CTGTGTAAGTTCAGGTACCTGGG - Intergenic
1058893142 9:109378544-109378566 CTGTGTACATGTGTGTGCCCAGG - Exonic
1060442157 9:123651375-123651397 GTGTGTACGTGCATGTGCTCAGG - Intronic
1062678716 9:137764208-137764230 CTGAGTAAAGGCATGTGCACCGG - Intronic
1186975320 X:14896222-14896244 CTAGGTATGTGCATGTGGCCTGG - Intronic
1188340644 X:28997030-28997052 CTGGGTAAGTCCATGATCCCTGG - Intronic
1188668045 X:32848995-32849017 GTGTGTATGTGCATGTGCTGGGG + Intronic
1190093267 X:47458599-47458621 CTGTGGAAGTGCAAATGGCCAGG + Intronic
1199817553 X:151412091-151412113 CTGTTTATGTGCATGTTCACAGG - Intergenic
1200490606 Y:3818344-3818366 CTGTGTCAGTGCATGTGAGATGG - Intergenic