ID: 988852150

View in Genome Browser
Species Human (GRCh38)
Location 5:35190746-35190768
Sequence CAGAATAAGATGGGCTCAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 194}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988852150 Original CRISPR CAGAATAAGATGGGCTCAGT AGG (reversed) Intronic
900730750 1:4257898-4257920 CAGACTGAGGTGGTCTCAGTTGG + Intergenic
901313502 1:8288851-8288873 CAGAGTAGGCTGGGCCCAGTGGG - Intergenic
901325713 1:8364092-8364114 AAGAGGATGATGGGCTCAGTGGG - Exonic
902570504 1:17344096-17344118 CAGACTGAGATGGTCTCAGATGG + Intronic
904140024 1:28345726-28345748 GAGAATCACCTGGGCTCAGTAGG + Intergenic
905938094 1:41840711-41840733 CAGGATCTGATGGGCTCCGTGGG - Intronic
907746877 1:57222506-57222528 CAGAAGTAGATGAGCTGAGTAGG + Intronic
907975485 1:59427335-59427357 CAGAAACAGATGGCCTCAGGTGG + Intronic
907988379 1:59555154-59555176 AAGAATGACATCGGCTCAGTGGG + Intronic
908066122 1:60406839-60406861 GAGAATAAGAAGGGCTTAGCTGG - Intergenic
909250148 1:73343655-73343677 CAGACTGAGATGGTCTCAGATGG + Intergenic
916019534 1:160779900-160779922 CAGGTTAACATGGGCTCGGTAGG + Intergenic
916892224 1:169123026-169123048 CATAATGAGGTGGGCTCAGGGGG - Intronic
921640069 1:217542700-217542722 CATAATAAGACTGGCTGAGTTGG + Intronic
922024361 1:221736966-221736988 CAGAGTAAGATTGCCTCAATGGG - Intronic
924421332 1:243912759-243912781 AAGAATAGGATGGGTTCAGAAGG + Intergenic
1064101183 10:12465649-12465671 AAAAATAAGATTGGCTCAGCTGG - Intronic
1065472150 10:26093474-26093496 CAGAATAGGATGGGTTCTGAAGG + Intronic
1066227671 10:33399992-33400014 CAGAATAAGATTGGCAGAGTGGG - Intergenic
1068027181 10:51660993-51661015 CAGAATGAAATGGGCTCATTTGG - Intronic
1075292195 10:121240298-121240320 CAGAATAAGAGGGGGTCAGAGGG - Intergenic
1076712742 10:132347622-132347644 CAAAGTCAGATGTGCTCAGTGGG + Intronic
1080004997 11:27397322-27397344 CAGAATAAGATGCACCCAATGGG - Intronic
1081532675 11:43973682-43973704 GAGCATAAGATGGTTTCAGTGGG + Intergenic
1082718086 11:56639995-56640017 AAGAATGAGGTGGTCTCAGTTGG + Intergenic
1082937828 11:58672792-58672814 TAGATGAAGAGGGGCTCAGTGGG - Intronic
1083893348 11:65607842-65607864 CAGAATAAGAAGGGGTCCGTGGG + Intronic
1084616822 11:70241978-70242000 CAGCATAAAATGGGCTAAGGTGG - Intergenic
1086395221 11:86408629-86408651 CATTATAGGCTGGGCTCAGTGGG - Intronic
1086999297 11:93397556-93397578 CAGAATTAGGCAGGCTCAGTGGG - Intronic
1087496011 11:98891417-98891439 CAGAATAATTTGGTCTCAGATGG - Intergenic
1090885346 11:130871240-130871262 GAGAATCACATGGGCTTAGTTGG - Intergenic
1091991212 12:4957461-4957483 CAGAATGAGAGGTGCTCAGCTGG + Intergenic
1092304019 12:7281045-7281067 CAGAATAATATGGCCTATGTCGG - Intergenic
1092789051 12:12056105-12056127 AGGAATAAGGTGGGGTCAGTGGG - Intronic
1097162345 12:57056655-57056677 AAAAACAAGATGGGCTCAGATGG - Exonic
1097553987 12:61114942-61114964 CAGGATGAGATGGTCTCAGATGG + Intergenic
1097669023 12:62514124-62514146 CAGGATGAGATGGTCTCAGATGG - Intronic
1098738202 12:74134933-74134955 AAGAAAAAGATAAGCTCAGTTGG + Intergenic
1100384852 12:94096304-94096326 CAGAAGAAGATGGGATAAGCTGG - Intergenic
1101250763 12:102932251-102932273 AAGTATAAGAAGGGCACAGTGGG - Intronic
1104396021 12:128433935-128433957 CAGAAAAAGAAGGCGTCAGTGGG + Intronic
1105642414 13:22279390-22279412 CAGGAGAAGCTGGGGTCAGTTGG + Intergenic
1105657569 13:22457347-22457369 CAGAATGAGATGGTCTCAGATGG - Intergenic
1106476202 13:30100198-30100220 CAAAATAAGATGAGATCATTAGG - Intergenic
1109084465 13:57951960-57951982 CAGACTGAGATGGTCTCAGATGG - Intergenic
1112113145 13:96324625-96324647 CAGATTAAGATGAGGTCATTGGG + Intronic
1113429099 13:110233754-110233776 GAAAATGAGATGGGCTCACTTGG - Intronic
1114380430 14:22198045-22198067 CAGGATAAGGTGGTCTCAGGTGG + Intergenic
1115289341 14:31752528-31752550 CAGGCTAAGATGGTCTCAGATGG - Intronic
1115298549 14:31857750-31857772 CAGGCTAAGATGGTCTCAGATGG - Intronic
1115919291 14:38354907-38354929 CAGATTGAGATGGTCTCAGATGG + Intergenic
1117840890 14:59859734-59859756 CAGAATGAGCTGGTCTCAGATGG + Intronic
1117906807 14:60597814-60597836 CAAAATCAGATGGGCTAACTTGG - Intergenic
1118543022 14:66851821-66851843 CAGAATAGAATGGGTTGAGTGGG + Intronic
1118975169 14:70670504-70670526 AAGAATTAGCTGGGCGCAGTGGG + Intronic
1121391108 14:93575640-93575662 GTCAATAAAATGGGCTCAGTTGG - Intronic
1122865247 14:104600967-104600989 CAGAGTCTGATGGGGTCAGTGGG + Intronic
1125233535 15:37484755-37484777 CAGGATGAGATGGTCTCAGGTGG - Intergenic
1130092335 15:80831384-80831406 CAGAGCTCGATGGGCTCAGTGGG + Intronic
1131850427 15:96537310-96537332 CTGAATAGGATGGTGTCAGTGGG - Intergenic
1131890001 15:96962687-96962709 AAGAATGAGAAGGCCTCAGTTGG - Intergenic
1134355292 16:13476673-13476695 AAGAACAAGAGGGGCTAAGTGGG - Intergenic
1135698458 16:24610709-24610731 CGGAATAAGATGGGCTGGGAAGG - Intergenic
1137550422 16:49433837-49433859 GAGCATAAGATGAGGTCAGTAGG + Intergenic
1137930888 16:52586348-52586370 CAATTTAAGCTGGGCTCAGTTGG - Intergenic
1140648994 16:77066232-77066254 CAGAAGAAAATGGGCTGAGTGGG - Intergenic
1142578815 17:927632-927654 CAGAAGGAGGCGGGCTCAGTGGG + Intronic
1143356968 17:6337562-6337584 CAGAAGGAGATTGGGTCAGTTGG - Intergenic
1144626627 17:16847273-16847295 CAGAAGGAGAGGGGCTCGGTGGG - Intergenic
1144879805 17:18425438-18425460 CAGAAGGAGAGGGGCTCGGTGGG + Intergenic
1145152429 17:20518946-20518968 CAGAAGGAGAGGGGCTCGGTGGG - Intergenic
1146163773 17:30573151-30573173 CAGAAGGAGAGGGGCTCCGTGGG - Intergenic
1151191630 17:72402512-72402534 CAGAAGGACATGGTCTCAGTTGG + Intergenic
1151849825 17:76683699-76683721 AAGAATGAGAAGGGCTCAGGTGG + Intronic
1152032364 17:77851815-77851837 CAGAAGAAGAGGGGCCCAGATGG - Intergenic
1152483214 17:80570309-80570331 CAGGAAAAGATGGACTAAGTAGG - Intronic
1156145338 18:34169077-34169099 CAGAATAAAATGATGTCAGTTGG + Intronic
1156207982 18:34906669-34906691 CAGACTAAGGTGGTCTCAGATGG - Intergenic
1159180358 18:64894096-64894118 CAGACTAAGGTGGTCTCAGATGG - Intergenic
1159684229 18:71397071-71397093 TGGAAAAAGATGGGCTCATTAGG + Intergenic
1161364782 19:3872117-3872139 CAGAAGTCGCTGGGCTCAGTAGG - Intergenic
1162218571 19:9157076-9157098 CAGGACAAGATGGCCTCAATGGG + Intronic
1162433287 19:10642288-10642310 CAGCATAGGATGGACTCAGGGGG + Intronic
1162498587 19:11037891-11037913 TGTAATAAGATGGGCTCAATGGG - Intronic
1163539201 19:17896984-17897006 CAAAATTAGCTGGGCGCAGTGGG - Intergenic
1163842619 19:19620504-19620526 GAGGATAAGTTGGGCTCAGGAGG + Intergenic
1165466161 19:35976364-35976386 CAGAATAGGCTGGGTGCAGTAGG - Intergenic
1166861427 19:45813857-45813879 CAGGATAAGAGGGTCTCAGGAGG + Intronic
925905619 2:8538196-8538218 GAGAAGGAGCTGGGCTCAGTGGG - Intergenic
926502687 2:13675271-13675293 CAGAATAAAATTGCTTCAGTAGG + Intergenic
926952315 2:18255642-18255664 CATAATAAGATGTAATCAGTAGG - Intronic
928039406 2:27859601-27859623 GTGAAGAAGATGGGCTCAGGTGG + Intronic
930506185 2:52285233-52285255 CAGGATGAGATGGTCTCAGATGG - Intergenic
931454056 2:62393174-62393196 CAGATTAAAATGAGCTTAGTAGG + Intergenic
931821911 2:65960766-65960788 CAGAATCAGATTGGCTCCATAGG + Intergenic
931949147 2:67341763-67341785 CAGAATAAAAGGGTCTTAGTAGG - Intergenic
932879431 2:75487073-75487095 CAGGATGAGATGGGCTCACATGG + Intronic
933011469 2:77069506-77069528 CAGAACAAGATGGCTTCACTGGG - Intronic
933942750 2:87258789-87258811 CAAATTAAGATGAGGTCAGTAGG + Intergenic
935425867 2:102917750-102917772 CAGGATGAGATGGTCTCAGATGG - Intergenic
935519854 2:104091477-104091499 CTTAATATGATGGGCTCAGTTGG + Intergenic
935586246 2:104802401-104802423 CATAAAGAGATGGGCTCAGCAGG - Intergenic
936337467 2:111602773-111602795 CAAATTAAGATGAGGTCAGTAGG - Intergenic
936876022 2:117190564-117190586 CACAATACGATGGCCTCATTCGG + Intergenic
937603757 2:123772001-123772023 GAGAATAACAAGGGCTCAGCTGG - Intergenic
941682706 2:168415739-168415761 CAGGCTAAGGTGGTCTCAGTTGG - Intergenic
942775211 2:179572827-179572849 CAGAATAAACAGGGCTTAGTGGG - Intronic
948655442 2:239474004-239474026 CAGAAGAAGATGAGCTCACAAGG - Intergenic
948881580 2:240860450-240860472 AAAAATAAGAAAGGCTCAGTTGG + Intergenic
1169609592 20:7364147-7364169 CAGGCTAAGATGGTCTCAGATGG + Intergenic
1169895804 20:10503920-10503942 CAGGTTAAGATGAGCTCATTAGG - Intronic
1170804065 20:19614559-19614581 CAGAATAACATGTGCTAAGTGGG - Intronic
1172284970 20:33733870-33733892 TAGAATAAGATGACCTCAGCTGG + Intronic
1175577891 20:60076189-60076211 CAGAGTAAAATTGGCTCATTGGG - Intergenic
1177039038 21:16083443-16083465 AAGAATAAGCTGTCCTCAGTCGG - Intergenic
1178392516 21:32210888-32210910 GAGAAGAAAATGGGCTGAGTAGG - Intergenic
1179450803 21:41467044-41467066 CAGAAAAGGATGGGCACAGCCGG + Intronic
1183097885 22:35564680-35564702 CAGCATATGGTGGGCTCACTTGG + Intergenic
952184185 3:30951022-30951044 CAGAAAAAGATGAGATCACTGGG + Intergenic
952624958 3:35392785-35392807 CAGGCTGAGATGGGCTCAGATGG - Intergenic
952636134 3:35534750-35534772 CAGAATAAAATTGGCCCAGAAGG + Intergenic
955646313 3:61141409-61141431 CAGAATAAGAAAGGCCCAGAGGG + Intronic
956455639 3:69418154-69418176 ATGAAAAAGATGGCCTCAGTAGG - Intronic
956875221 3:73456377-73456399 AAGAATAAGATTGGCTCACTTGG - Intronic
958836159 3:99147716-99147738 CAGACTAAGGTGGTCTCAGATGG + Intergenic
959653842 3:108778681-108778703 CACAGTCAGAGGGGCTCAGTAGG - Intergenic
960581360 3:119282017-119282039 CAGACTGAGATGGTCTCAGATGG + Intergenic
960944187 3:122954761-122954783 CAGAAAAATATGGGCCCTGTGGG + Intronic
961262686 3:125615335-125615357 CAGAAGAAGATGGGATAAGCTGG + Intergenic
964164643 3:153687936-153687958 AAGAAGGATATGGGCTCAGTTGG + Intergenic
965766642 3:172137363-172137385 CAGAAGAATATGGGCTGAGTAGG + Intronic
967362313 3:188645672-188645694 CAAGAAAAGAAGGGCTCAGTAGG - Intronic
967412593 3:189181587-189181609 CAGGCTAAGATGGTCTCAGATGG - Intronic
969265700 4:6062822-6062844 CAGAATGGGAGGTGCTCAGTGGG - Intronic
970606826 4:17689033-17689055 CAGAAGAAAATGTGCCCAGTAGG + Intronic
971684548 4:29747363-29747385 CAGACTGAGATGGTCTCAGATGG - Intergenic
973983657 4:56328345-56328367 AAAACTAAGATGGGCACAGTTGG - Exonic
974494733 4:62612140-62612162 CAGAAGAAGATGGGCTTTTTTGG + Intergenic
974569555 4:63627510-63627532 CAGACTAAGGTGGTCTCAGATGG + Intergenic
976333240 4:83855848-83855870 CAGAATAATATGGCCTTAGCTGG - Intergenic
979060984 4:116059902-116059924 CAGAATGAGGTGGCCTCAGATGG - Intergenic
979312436 4:119219459-119219481 CAGATTAAGATGAGGTCACTGGG - Intronic
979390210 4:120118634-120118656 CAGACTGAGATGGTCTCAGATGG - Intergenic
979464724 4:121022947-121022969 CAGATTAAGGTGGTCTCAGATGG - Intergenic
979725595 4:123956581-123956603 CTGAGTATGATGGGCTAAGTAGG + Intergenic
979764479 4:124447481-124447503 CAGGCTAAGATGGTCTCAGATGG - Intergenic
987805991 5:22769288-22769310 TAGAAGAAGATGGGATCAGCTGG + Intronic
988813424 5:34807244-34807266 CAGAATAAGATGAGCCAAGCAGG + Intronic
988852150 5:35190746-35190768 CAGAATAAGATGGGCTCAGTAGG - Intronic
988993382 5:36692752-36692774 CAGAACAACACTGGCTCAGTAGG + Intergenic
990772539 5:59265302-59265324 CAAAATAAGAAGTGGTCAGTGGG - Intronic
991403039 5:66274114-66274136 GGGAATAAAATGGCCTCAGTTGG + Intergenic
993172503 5:84436788-84436810 TAGAATATGATGGCTTCAGTAGG + Intergenic
993567218 5:89490411-89490433 CAGAATAAGATGAGAGGAGTAGG + Intergenic
993711650 5:91230981-91231003 CAGGATAAGGTGGTCTCAGATGG - Intergenic
995113430 5:108453316-108453338 CAGGATAAGGTGGTCTCAGATGG + Intergenic
995279812 5:110321079-110321101 CAGAATGAGATTGGGTCATTTGG + Intronic
997116054 5:131126839-131126861 CAGGCTAAGATGGTCTCAGATGG + Intergenic
998486178 5:142504576-142504598 CATAAGAAGATGGACACAGTGGG - Intergenic
999655868 5:153810132-153810154 CAGAATCAGATGAGTTAAGTGGG - Intronic
1001067468 5:168548284-168548306 CAGGATAACATGGTCTCAGGGGG + Intergenic
1001924977 5:175629552-175629574 CAGAATAAGAGGGACAGAGTGGG - Intergenic
1002447159 5:179296617-179296639 CAGGTGGAGATGGGCTCAGTGGG + Intronic
1006979092 6:38132209-38132231 ATGAATAAGATGGGTTCTGTGGG + Intronic
1010495123 6:76525170-76525192 CAAATTAGGCTGGGCTCAGTTGG + Intergenic
1012745239 6:103078672-103078694 CAGGATGAGATGGTCTCAGATGG - Intergenic
1013024176 6:106253282-106253304 CAGAAGTAGGTGGGCCCAGTGGG + Intronic
1014189771 6:118481549-118481571 CAGAATTAGAAATGCTCAGTGGG + Intronic
1016527982 6:145024471-145024493 CTGAATAAGAAGCTCTCAGTCGG + Intergenic
1018977688 6:168577896-168577918 TAGAAAAAGATGGATTCAGTGGG - Intronic
1021677153 7:23092280-23092302 CAAAATGAGATAGGCTGAGTTGG - Intergenic
1023672451 7:42592269-42592291 CACTATAAGATGTGGTCAGTAGG + Intergenic
1023689600 7:42772481-42772503 TAGAGTAACATGGGTTCAGTTGG - Intergenic
1024483584 7:49890967-49890989 CAAAAAAAGATGGGCTAAATAGG + Intronic
1024976478 7:55118405-55118427 TAGAGTAAGATAGGCTCAGTAGG + Intronic
1027257875 7:76442874-76442896 TAGAATAAATTGGGCACAGTGGG - Intergenic
1027280973 7:76609157-76609179 TAGAATAAGTTGGGCACAGTGGG + Intergenic
1028048317 7:86151695-86151717 CAGACTAAGGTGGTCTCAGATGG + Intergenic
1030150970 7:106404563-106404585 CAGAAAAAGAAGGACTGAGTAGG + Intergenic
1034452949 7:151147476-151147498 CAGAATAAGATTGGTTGAGGGGG - Intergenic
1035786789 8:2267659-2267681 AAGAATAAAACGGTCTCAGTAGG + Intergenic
1035806018 8:2454057-2454079 AAGAATAAAACGGTCTCAGTAGG - Intergenic
1037155684 8:15695722-15695744 CAGACTAAGGTGGTCTCAGATGG + Intronic
1038075289 8:24066432-24066454 CTGAACATTATGGGCTCAGTAGG + Intergenic
1041734234 8:61093018-61093040 CAAAATGGGAAGGGCTCAGTAGG + Intronic
1042480619 8:69298078-69298100 CAGAAGTTCATGGGCTCAGTGGG + Intergenic
1044127101 8:88472176-88472198 CAGACTGAGATGGTCTCAGACGG - Intergenic
1044220524 8:89664056-89664078 CAGGATGAGATGGTCTCAGATGG - Intergenic
1045195964 8:99930851-99930873 GAGAAAAAGATGAACTCAGTTGG + Intergenic
1045675783 8:104607007-104607029 CAGACTGAGATGGTCTCAGATGG + Intronic
1047457124 8:125025170-125025192 AAGACTAAATTGGGCTCAGTTGG + Intronic
1048508212 8:135039872-135039894 CAGAAAATGATGGGCAGAGTTGG - Intergenic
1051597351 9:18838482-18838504 CAGAATTAGATAGCCTCAGGTGG + Intronic
1052298113 9:26921472-26921494 CAGATTAAGATGGGGTAAGAGGG - Intronic
1052669335 9:31535415-31535437 CAGAACAAGCTGTGCCCAGTAGG - Intergenic
1054897439 9:70329542-70329564 CAGATTAAGGTGGTCTCAGATGG - Intronic
1056211533 9:84369238-84369260 CAGATGAAGATGGACTCTGTAGG + Intergenic
1056211835 9:84372053-84372075 CAGATGAAGATGGACTCTGTAGG + Intergenic
1059151694 9:111954991-111955013 CACCATAATATGGACTCAGTGGG + Intergenic
1061134557 9:128725880-128725902 CAGGATCTGATGTGCTCAGTGGG + Intergenic
1187057119 X:15751463-15751485 CAGAATAAGCCAGTCTCAGTAGG - Intronic
1188317993 X:28699613-28699635 CAGATTAAGATGGTCTCAGCAGG + Intronic
1188959852 X:36477927-36477949 AAGAATAAAATGGGGTTAGTAGG - Intergenic
1193153350 X:78147536-78147558 CAGGTTAAGATGGTCTCAGATGG + Intergenic
1193759272 X:85443881-85443903 CAGGCTAAGATGGTCTCAGATGG - Intergenic
1197813875 X:130476783-130476805 TAGAAAAAGAAGGGCTGAGTTGG + Intergenic
1199400273 X:147390356-147390378 TGGTATAAGATGGGGTCAGTTGG - Intergenic