ID: 988853348

View in Genome Browser
Species Human (GRCh38)
Location 5:35200766-35200788
Sequence ATCTTCCCCTGTAAGATATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 120}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988853342_988853348 16 Left 988853342 5:35200727-35200749 CCAGGTCAGAGAGACCCTACATA 0: 1
1: 0
2: 0
3: 6
4: 85
Right 988853348 5:35200766-35200788 ATCTTCCCCTGTAAGATATCAGG 0: 1
1: 0
2: 0
3: 15
4: 120
988853345_988853348 1 Left 988853345 5:35200742-35200764 CCTACATACGCCTGGCCTGACTG 0: 1
1: 0
2: 0
3: 6
4: 90
Right 988853348 5:35200766-35200788 ATCTTCCCCTGTAAGATATCAGG 0: 1
1: 0
2: 0
3: 15
4: 120
988853344_988853348 2 Left 988853344 5:35200741-35200763 CCCTACATACGCCTGGCCTGACT 0: 1
1: 0
2: 0
3: 3
4: 65
Right 988853348 5:35200766-35200788 ATCTTCCCCTGTAAGATATCAGG 0: 1
1: 0
2: 0
3: 15
4: 120
988853346_988853348 -9 Left 988853346 5:35200752-35200774 CCTGGCCTGACTGAATCTTCCCC 0: 1
1: 0
2: 0
3: 28
4: 220
Right 988853348 5:35200766-35200788 ATCTTCCCCTGTAAGATATCAGG 0: 1
1: 0
2: 0
3: 15
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988853348 Original CRISPR ATCTTCCCCTGTAAGATATC AGG Intronic
906918088 1:50033288-50033310 ATTTTCCCCTGTAATATCACAGG - Intergenic
910204673 1:84737211-84737233 TTCTTCCCTGGTAAGATTTCTGG - Intergenic
911428048 1:97746563-97746585 TTCTTACCCTGGAAGATATCTGG + Intronic
912263115 1:108128876-108128898 ATGTTCCCCCTTAAGATATAGGG - Intergenic
919149706 1:193680200-193680222 ATTTTCCCCTGTAAGTTTTGGGG + Intergenic
919198651 1:194322090-194322112 GTTTTCCCATGGAAGATATCAGG + Intergenic
919648275 1:200118758-200118780 AAGTTCCCCTGTAAGAGAACTGG + Intronic
920939848 1:210471544-210471566 ATCTTCCTCTGTAAGGCATTAGG - Intronic
921236308 1:213135000-213135022 ATCTTTCCCCCTGAGATATCAGG - Intronic
921948559 1:220906082-220906104 ATCTTTCCCTGTGATATAGCTGG - Intergenic
924016559 1:239731671-239731693 ATCTTCCCCTTTTGAATATCTGG + Intronic
1063179549 10:3585448-3585470 TTCTTTCCTTGTAAGATCTCTGG + Intergenic
1067998602 10:51304857-51304879 TTCTTCATCTGTAAGATATGTGG - Intronic
1070531327 10:77339783-77339805 ATCTTCCCCTGCAGAATATGTGG - Intronic
1071274330 10:84038996-84039018 AACTCCCCCTGTAGGATATAAGG - Intergenic
1071545442 10:86525415-86525437 ATCTTCCCATCTAACATATCAGG + Intergenic
1072288994 10:93945090-93945112 TTCCTCCCCTTTAAAATATCAGG + Intronic
1072445897 10:95498236-95498258 TTCTTCCTCTGTAAGATAAAAGG + Intronic
1072560769 10:96571542-96571564 ATATTCCCCAGGCAGATATCTGG + Intronic
1074254037 10:111782610-111782632 ATCTTCACCTGAATGATATATGG - Intergenic
1077619371 11:3706437-3706459 AACTTCACCTGTAAGACATGTGG + Exonic
1080214240 11:29823056-29823078 ATCCTCATCTGTAAGGTATCTGG + Intergenic
1090140861 11:124259018-124259040 TTCTTCCCATATAAGATATCTGG - Intergenic
1090371224 11:126254495-126254517 ATGTTCCCCTTTAAGATCTATGG - Intronic
1090539335 11:127683294-127683316 ATCTCACCCTGTATGATATCTGG + Intergenic
1091366554 11:135026074-135026096 ACTTTCCACTGTAAGATTTCTGG - Intergenic
1093861173 12:24169753-24169775 TTATTCCCCTCAAAGATATCAGG + Intergenic
1097953817 12:65462820-65462842 ATCTTCCCTTGTAAGAAACATGG - Intronic
1098940179 12:76525243-76525265 ATATTATCCTGTAAAATATCAGG - Intronic
1100239316 12:92694940-92694962 ATCTTGCCGTGAAAGATAGCAGG + Intergenic
1100247565 12:92777645-92777667 ACCTTCTCCTTTAAGACATCTGG + Exonic
1100544459 12:95588114-95588136 ATCTACCCTTGTAGGATTTCAGG - Intergenic
1101467869 12:104966368-104966390 CTCTTGCCCTGTAACATAACAGG + Intergenic
1103921771 12:124403001-124403023 ATCTGCCCCTCTTAAATATCCGG - Intronic
1107070940 13:36268355-36268377 ATCTGCTCCTGAATGATATCTGG + Intronic
1108978253 13:56477286-56477308 ATCTTCCTCTTTAAAATATTTGG - Intergenic
1118065113 14:62182131-62182153 ATCTTCTACTGTAGGATATTAGG - Intergenic
1126286588 15:47019395-47019417 TTCTTCTCCTGTTAGATCTCTGG - Intergenic
1127361667 15:58249592-58249614 ATCATTCCTTCTAAGATATCAGG + Intronic
1127634128 15:60852966-60852988 ATCTCCCCCTGAAAGATTGCCGG + Intronic
1127637877 15:60888711-60888733 CTCTTTCCCTTTAAGACATCAGG + Intronic
1136684944 16:31988607-31988629 ATCTTCCCCTGGCAGAAACCAGG + Intergenic
1136785560 16:32932142-32932164 ATCTTCCCCTGGCAGAAACCAGG + Intergenic
1136884213 16:33921662-33921684 ATCTTCCCCTGGCAGAAACCAGG - Intergenic
1137085596 16:36117995-36118017 ATGTTCCTGTGTTAGATATCTGG - Intergenic
1138116110 16:54361965-54361987 TTGTTCCCCTGTGAGCTATCTGG - Intergenic
1138366113 16:56479089-56479111 ATGTTCACCTGTAAAATATATGG + Exonic
1140836188 16:78796336-78796358 TTCTTCCCCTGTCAGATGTCTGG - Intronic
1143655862 17:8293236-8293258 ATCTGCCCCTTTGAGTTATCTGG - Intronic
1144118665 17:12127946-12127968 ATCTTCCTCTGTAATATGTTTGG + Intronic
1146436943 17:32859030-32859052 ATCCTCCACTGAAAGAAATCAGG - Intronic
1148599204 17:48881306-48881328 CCCTTCACCTGTAAGATGTCGGG - Intergenic
1150332140 17:64303019-64303041 ATCTACCCCTGTAGGATTCCAGG + Intergenic
1153996635 18:10447795-10447817 ATCTCCCCCTGTGAGATAGCTGG - Intergenic
1154246207 18:12702139-12702161 ATATTCTGCTGTAAGATATCAGG - Intronic
1157176008 18:45453003-45453025 ATCTTGCTCTCTAAGATGTCCGG - Intronic
1158825943 18:61219408-61219430 ATCTTTCCCTATAAGATGTATGG + Intergenic
1167279399 19:48558142-48558164 ATCATCCCCTGTAAGAGGTGAGG + Intronic
1168623801 19:57900712-57900734 AGCTTCCCCTGTTTGATATGTGG - Intronic
926080760 2:9984302-9984324 ATCTTCCCCTGTCAGCTCACGGG + Intronic
930093063 2:47545407-47545429 AGCTTCCCCTGAAAGAAACCAGG + Intronic
930887352 2:56341258-56341280 CACTTCCCCAGTAAGATCTCTGG - Intronic
935096081 2:99945584-99945606 ATTTTCCCCTGCTAGATAGCAGG - Intronic
935877931 2:107532311-107532333 ATCTTACCCTTTAAAATATTAGG + Intergenic
938234091 2:129687396-129687418 AACATCCCCTGCTAGATATCAGG - Intergenic
938993612 2:136654854-136654876 ATCTTCCCTAGTGAGAAATCTGG + Intergenic
947146548 2:227071781-227071803 ATCTGCTCCTGAATGATATCTGG + Intronic
1170215218 20:13884401-13884423 ATCCTCCTCTGTAAGATGCCAGG - Intronic
1171448307 20:25219781-25219803 ATCCTACCCTGTCAGATACCAGG - Intronic
1173419126 20:42884985-42885007 TACTTCCCCTGAAACATATCAGG + Intronic
1177627299 21:23679295-23679317 ATCTTCCTTTGTAATATATTTGG + Intergenic
1184800164 22:46754136-46754158 ATCTGGCCCAGTCAGATATCTGG + Intergenic
1184816587 22:46876587-46876609 CTCTTCCCCTGAAAGCTACCAGG - Intronic
949294080 3:2500186-2500208 ATCTTCCCCTGAATAATACCAGG + Intronic
952784158 3:37135830-37135852 ATTTACCCCTGTAATATATGAGG - Intronic
955474989 3:59327335-59327357 ATCTTCCCTTGTAGAATAGCAGG + Intergenic
955737946 3:62059436-62059458 ATCTTACCTTGTAAGAAATATGG + Intronic
958164459 3:89861766-89861788 TTCTTTCCCTGGAAGATATCTGG - Intergenic
964178372 3:153853848-153853870 ATCATCTCCTTTAAGTTATCAGG - Intergenic
964694325 3:159490793-159490815 ATTTTCACTTGTAAGATAACTGG + Intronic
965387595 3:168063541-168063563 ATCTTCCCCACTGAGATATTGGG + Intronic
968265387 3:197358934-197358956 ATCTCCTCCTGTATGATATTAGG + Intergenic
969027974 4:4189697-4189719 ATCTTCTCCTGTAAGACAGGTGG + Intronic
969218304 4:5741177-5741199 ATTCACCCCTGTAAGACATCTGG - Intronic
970978737 4:22072415-22072437 ATCTTTCCCTTTAAGAAGTCAGG - Intergenic
972162397 4:36243698-36243720 AGGTTCCCGTGTAAGGTATCGGG + Intronic
972174723 4:36389274-36389296 ATCTTTCTCTGTAATTTATCGGG - Intergenic
979195158 4:117912595-117912617 ATCTGCCCCTGAAGGATTTCTGG - Intergenic
980025831 4:127765315-127765337 ATCTTCCTCTGTAAGAAAATAGG + Intronic
980251429 4:130320554-130320576 ACATTCCCCTGTAAAATATAAGG - Intergenic
982850082 4:160303202-160303224 AGCTTCCACCGAAAGATATCGGG - Intergenic
987056178 5:14194856-14194878 ATATTAACATGTAAGATATCTGG - Intronic
987788936 5:22538425-22538447 ATTATCTGCTGTAAGATATCAGG - Intronic
988853348 5:35200766-35200788 ATCTTCCCCTGTAAGATATCAGG + Intronic
989334933 5:40304885-40304907 ATCTTCCCCTCAAAGAAAGCAGG + Intergenic
990949100 5:61278669-61278691 TTCTTCCCCTTTAAGAAATCTGG - Intergenic
994102123 5:95904864-95904886 ATCCTCCCAAGAAAGATATCAGG - Intronic
994680274 5:102878118-102878140 ATATCCCTCTGTAAGATATTTGG + Intronic
995988244 5:118206962-118206984 TTCTTGCTCTGTAAGATTTCTGG + Intergenic
996988581 5:129600059-129600081 ATCATCCACTATAAGATATAAGG + Intronic
997710666 5:136001435-136001457 CTCTTCCCCTGCAAGAGTTCAGG + Intergenic
998506453 5:142676118-142676140 ATCTTCCCCTGGAAGAAAAAAGG + Intronic
999080041 5:148834807-148834829 AGCTTCCCCTGCCAGATAGCAGG + Intergenic
999352945 5:150894315-150894337 GTTTTCCCCTGTAAGTTTTCAGG + Intronic
999544330 5:152610257-152610279 AACTTCCCATGAATGATATCAGG - Intergenic
1000040630 5:157482003-157482025 ATTTTAACCTGTAAGATATCAGG - Intronic
1002795974 6:471257-471279 ATTTTCTACTGTAAGATATCAGG - Intergenic
1013789402 6:113819204-113819226 TTATTCCCCTGTTAGATAACAGG - Intergenic
1013868628 6:114728442-114728464 ATCTTCCCCTCAACAATATCTGG + Intergenic
1013975390 6:116071982-116072004 AACATCCCCTGCTAGATATCAGG + Intergenic
1015298308 6:131624429-131624451 AGCTTCCCCACTCAGATATCTGG - Intronic
1017812659 6:157995235-157995257 ATCTTCTCCTTTTAGATTTCAGG + Intronic
1020158192 7:5745085-5745107 ATCTCCACCTGTAAGATCTACGG + Intronic
1020933635 7:14431994-14432016 ATTTTCCCCTGAAACATACCTGG - Intronic
1020960221 7:14793500-14793522 ATCTTCAGCTGTTAGAAATCAGG + Intronic
1022799347 7:33760938-33760960 AGCTTCCCCTGTATACTATCAGG - Intergenic
1030363302 7:108618271-108618293 ATCTTACCAGGTAAGAGATCAGG + Intergenic
1035658042 8:1325939-1325961 ATCTTCCCCCGTAAGCTATAAGG + Intergenic
1042582968 8:70302552-70302574 ATGTTTACCTGTAAGTTATCAGG - Intronic
1043487203 8:80709879-80709901 AGCTTCGCTTGTAAGATATCAGG + Intronic
1047673604 8:127175053-127175075 ATTTGCACCCGTAAGATATCAGG - Intergenic
1053244819 9:36526197-36526219 ATGTTCCCCTGTAAGTGATAGGG + Intergenic
1053587909 9:39479590-39479612 ATGTTCCTCTGGAAGATATGGGG + Intergenic
1054578393 9:66885652-66885674 ATGTTCCTCTGGAAGATATGGGG - Intronic
1056234539 9:84580512-84580534 ATCTTCCCCTTAAAGAAAGCAGG + Intergenic
1056295027 9:85184230-85184252 AACTTGACCTGTAAGACATCTGG - Intergenic
1056884313 9:90426098-90426120 CTCCTCCCCTGGAAGAGATCAGG + Intergenic
1058146701 9:101420107-101420129 ACCTTGCCCTGTAAGATCTCTGG + Intergenic
1059788296 9:117611269-117611291 ATCTCCCCCTGTAAGCAATTAGG + Intergenic
1186571917 X:10724023-10724045 ATCTTACTCTGTAAGATATTAGG + Intronic
1189023118 X:37363100-37363122 TTATTACCCTGTAAGATATATGG + Intronic
1190857980 X:54316088-54316110 ATCTTCCCCTGTATTATAGATGG + Intronic
1195612950 X:106889822-106889844 CTCTTCCCCTATTAGATATATGG - Intronic
1197778758 X:130138918-130138940 ATCTTCCCCAGGAGGACATCTGG + Intronic
1199010088 X:142747388-142747410 ATGTTCTCCTGTAAGATTCCAGG + Intergenic
1201913350 Y:19156182-19156204 ATCTTCACCTGTAAGTTTTATGG - Intergenic