ID: 988856680

View in Genome Browser
Species Human (GRCh38)
Location 5:35233926-35233948
Sequence AAACCTAGGCCATTAGAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988856680_988856688 16 Left 988856680 5:35233926-35233948 CCAGTTTCTAATGGCCTAGGTTT No data
Right 988856688 5:35233965-35233987 CCGCCTGGCTCTAAAAGCCGGGG No data
988856680_988856683 1 Left 988856680 5:35233926-35233948 CCAGTTTCTAATGGCCTAGGTTT No data
Right 988856683 5:35233950-35233972 CATATCAAAGGTTGCCCGCCTGG No data
988856680_988856684 14 Left 988856680 5:35233926-35233948 CCAGTTTCTAATGGCCTAGGTTT No data
Right 988856684 5:35233963-35233985 GCCCGCCTGGCTCTAAAAGCCGG No data
988856680_988856686 15 Left 988856680 5:35233926-35233948 CCAGTTTCTAATGGCCTAGGTTT No data
Right 988856686 5:35233964-35233986 CCCGCCTGGCTCTAAAAGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988856680 Original CRISPR AAACCTAGGCCATTAGAAAC TGG (reversed) Intergenic
No off target data available for this crispr