ID: 988859593

View in Genome Browser
Species Human (GRCh38)
Location 5:35263836-35263858
Sequence TGTGGTCCACGGACCTCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988859593_988859600 4 Left 988859593 5:35263836-35263858 CCCCCAGAGGTCCGTGGACCACA No data
Right 988859600 5:35263863-35263885 GAAAACATTGTTAAAGGATATGG No data
988859593_988859601 5 Left 988859593 5:35263836-35263858 CCCCCAGAGGTCCGTGGACCACA No data
Right 988859601 5:35263864-35263886 AAAACATTGTTAAAGGATATGGG No data
988859593_988859599 -2 Left 988859593 5:35263836-35263858 CCCCCAGAGGTCCGTGGACCACA No data
Right 988859599 5:35263857-35263879 CACATTGAAAACATTGTTAAAGG No data
988859593_988859602 29 Left 988859593 5:35263836-35263858 CCCCCAGAGGTCCGTGGACCACA No data
Right 988859602 5:35263888-35263910 CAATTCAGTTTTAATCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988859593 Original CRISPR TGTGGTCCACGGACCTCTGG GGG (reversed) Intergenic
No off target data available for this crispr