ID: 988865780

View in Genome Browser
Species Human (GRCh38)
Location 5:35332881-35332903
Sequence AGCTCGGATGTCGCTTCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988865778_988865780 -7 Left 988865778 5:35332865-35332887 CCATCATTCTGGTCTCAGCTCGG No data
Right 988865780 5:35332881-35332903 AGCTCGGATGTCGCTTCACCAGG No data
988865776_988865780 -5 Left 988865776 5:35332863-35332885 CCCCATCATTCTGGTCTCAGCTC No data
Right 988865780 5:35332881-35332903 AGCTCGGATGTCGCTTCACCAGG No data
988865777_988865780 -6 Left 988865777 5:35332864-35332886 CCCATCATTCTGGTCTCAGCTCG No data
Right 988865780 5:35332881-35332903 AGCTCGGATGTCGCTTCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988865780 Original CRISPR AGCTCGGATGTCGCTTCACC AGG Intergenic
No off target data available for this crispr