ID: 988868375

View in Genome Browser
Species Human (GRCh38)
Location 5:35360617-35360639
Sequence TGTTTGATAGTTCACTTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988868375_988868379 24 Left 988868375 5:35360617-35360639 CCTCCAAAGTGAACTATCAAACA No data
Right 988868379 5:35360664-35360686 AAAAAGAACACTGTACATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988868375 Original CRISPR TGTTTGATAGTTCACTTTGG AGG (reversed) Intergenic
No off target data available for this crispr