ID: 988868379

View in Genome Browser
Species Human (GRCh38)
Location 5:35360664-35360686
Sequence AAAAAGAACACTGTACATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988868377_988868379 21 Left 988868377 5:35360620-35360642 CCAAAGTGAACTATCAAACAGGT No data
Right 988868379 5:35360664-35360686 AAAAAGAACACTGTACATTTTGG No data
988868375_988868379 24 Left 988868375 5:35360617-35360639 CCTCCAAAGTGAACTATCAAACA No data
Right 988868379 5:35360664-35360686 AAAAAGAACACTGTACATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988868379 Original CRISPR AAAAAGAACACTGTACATTT TGG Intergenic
No off target data available for this crispr