ID: 988868760

View in Genome Browser
Species Human (GRCh38)
Location 5:35364659-35364681
Sequence AGTGACTACGTGGGTTTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988868753_988868760 21 Left 988868753 5:35364615-35364637 CCAGTCTCATAAAGTCACCTGTG No data
Right 988868760 5:35364659-35364681 AGTGACTACGTGGGTTTAGAAGG No data
988868755_988868760 4 Left 988868755 5:35364632-35364654 CCTGTGGATCAAGAGCATCCAAA No data
Right 988868760 5:35364659-35364681 AGTGACTACGTGGGTTTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988868760 Original CRISPR AGTGACTACGTGGGTTTAGA AGG Intergenic
No off target data available for this crispr