ID: 988870654

View in Genome Browser
Species Human (GRCh38)
Location 5:35385364-35385386
Sequence GTGTAGGCCTGCAGGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988870645_988870654 6 Left 988870645 5:35385335-35385357 CCCCGAGCTGCGTTGCTTTCTCC No data
Right 988870654 5:35385364-35385386 GTGTAGGCCTGCAGGGAGGCAGG No data
988870644_988870654 7 Left 988870644 5:35385334-35385356 CCCCCGAGCTGCGTTGCTTTCTC No data
Right 988870654 5:35385364-35385386 GTGTAGGCCTGCAGGGAGGCAGG No data
988870641_988870654 18 Left 988870641 5:35385323-35385345 CCCTCACCGCTCCCCCGAGCTGC No data
Right 988870654 5:35385364-35385386 GTGTAGGCCTGCAGGGAGGCAGG No data
988870639_988870654 28 Left 988870639 5:35385313-35385335 CCAAAAGGGCCCCTCACCGCTCC No data
Right 988870654 5:35385364-35385386 GTGTAGGCCTGCAGGGAGGCAGG No data
988870646_988870654 5 Left 988870646 5:35385336-35385358 CCCGAGCTGCGTTGCTTTCTCCA No data
Right 988870654 5:35385364-35385386 GTGTAGGCCTGCAGGGAGGCAGG No data
988870643_988870654 12 Left 988870643 5:35385329-35385351 CCGCTCCCCCGAGCTGCGTTGCT No data
Right 988870654 5:35385364-35385386 GTGTAGGCCTGCAGGGAGGCAGG No data
988870640_988870654 19 Left 988870640 5:35385322-35385344 CCCCTCACCGCTCCCCCGAGCTG No data
Right 988870654 5:35385364-35385386 GTGTAGGCCTGCAGGGAGGCAGG No data
988870647_988870654 4 Left 988870647 5:35385337-35385359 CCGAGCTGCGTTGCTTTCTCCAC No data
Right 988870654 5:35385364-35385386 GTGTAGGCCTGCAGGGAGGCAGG No data
988870642_988870654 17 Left 988870642 5:35385324-35385346 CCTCACCGCTCCCCCGAGCTGCG No data
Right 988870654 5:35385364-35385386 GTGTAGGCCTGCAGGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988870654 Original CRISPR GTGTAGGCCTGCAGGGAGGC AGG Intergenic
No off target data available for this crispr